Gateway cloning¶

A phage enzyme swaps a pair of 25-base att sites between two plasmids, so an insert moves from one backbone into the next with no cut and no ligase. One command plans the BP reaction that makes the entry clone and the LR reaction that moves it on, designs the primers, builds both clones, and writes the bench protocol.

When to use it¶

• One insert bound for several destination vectors: make the entry clone once, and each destination after it is one reaction and one plate.
• The vector you want is sold as a Gateway destination and nothing else.
• Your construct can carry a whole 25-base att site at each end of the insert.

Use Golden Gate or Gibson when the join has to read what you chose, and restriction and ligation when the plasmids already share a usable pair of sites.

What it cannot do¶

It looks for att sites in your own files and refuses a record that has none. An insert without one needs --amplify first; a destination vector without one is refused outright, and the run names the count it found.

What you need¶

Three files: the insert or the entry clone, a donor vector and a destination vector. No record shipped with the repo carries an att site, so this example brings its own: pDONR-demo, 661 bp with two attP sites, and pDEST-demo, 473 bp with two attR sites. Both are built from the published att sequences, everything outside those sites is filler, and neither is a plasmid to order. Your own run takes a real pDONR and a real pDEST.

Run it¶

pixi run mbio cloning gateway plan tests/data/GFP.dna docs/examples/gateway/destination.gb \
  --donor docs/examples/gateway/donor.gb --amplify --out plan/

It prints the design in one line, then the seven files it wrote:

pDEST-demo-GFP: 915 bp, BP then LR, 751 bp insert, junctions attB1 at 89, attB2 at 831, checks warn
plan/entry-clone.dna
plan/product.dna
plan/primers.tsv
plan/protocol.json
plan/entry-clone-map.html
plan/product-map.html
plan/protocol.html

Read that line before anything else. GFP carries no att site, so --amplify put one on each end by PCR: each primer carries 4 G residues, the 25 bp att site and the frame bases the fusion needs, 29 bases either way. BP then LR is two reactions on two days: BP makes the entry clone, and LR moves the same 751 bp on into the destination.

checks warn means nothing failed, but something wants a look: two oligos out of six, on GC, hairpin and longest run. A junction here is the whole 25-base att site, not a few bases of scar. attB1 spells ACAAGTTTGTACAAAAAAGCAGGCT, attB2 spells ACCACTTTGTACAAGAAAGCTGGGT, and a fusion reads through both.

What it wrote¶

Each name links to what that run wrote, published here unedited; seven files rather than five, because BP ran and wrote the entry clone and its map. Nothing is typed by hand, so the same three inputs always give the same seven. To change the design, change the command and run it again. To change what the page says, edit protocol.json and make the page from it again:

pixi run mbio protocol render plan/protocol.json

How to read the protocol¶

Open protocol.html. The top states the whole design in ten cards and six sentences. The 4 G residues leave with the BP by-product, so this entry clone is the same record as one made from an insert that already had attB ends. LR drops 751 bp into the 164 bp of destination vector outside its own att sites, and the ccdB cassette leaves with it. GFP sits 8 bp downstream of the T7 promoter with a ribosome binding site ahead of it, so this clone may make its protein.

Under them sit the badges, and each reaction is judged in its own right: BP junctions reads attL1 at 136 and attL2 at 878, LR junctions attB1 at 89 and attB2 at 831. One badge carries no verdict, because nothing sourced judges it: grow the donor and destination in One Shot ccdB Survival 2 T1R, the only strain that grows one.

Then thirteen numbered steps, with a miniprep between the two reactions. Each is set up, run at 25 °C, stopped with proteinase K, transformed and plated. CcdB kills TOP10, so unreacted vector does not grow. Name an F′ strain with --host and that badge turns red: F′ brings ccdA and cancels the selection. At the screen a correct clone gives 871 bp and an empty vector 429 bp.

Before you order¶

• Read the protocol once, top to bottom.
• Look at every badge that is not green, and decide about it.
• Answer the badge with no verdict: which strain grows your vectors.
• Check the product map holds what you meant to clone.
• Check the two screening lanes can still be told apart.

Tips and troubleshooting¶

The fusion has to stay in frame. The attB tail adds frame bases only at an end you name with --fusion, and none by default. Nothing in a map says which coding sequence is a tag, so it asks rather than guessing.

The entry clone will not grow on your plate. Pick it on kanamycin, which comes from the donor's own KanR. The expression clone after LR goes on ampicillin or carbenicillin instead.

Your insert already carries an att site. The plan looks inside the DNA that moves and fails that check when it finds one. Recombination would then happen where nobody meant it to.

Where the numbers come from¶

The att sites are the published ones, and the plan looks for them in your own file rather than holding a copy of one vendor's vector. The 7 bases at the centre must match exactly; the rest of the 25 may differ by one, because the vendor says these sequences drift between products.

Volumes, units, times and temperatures are Invitrogen's for the two Clonase mixes and NEB's for the PCR and the gels, cited step by step inside the protocol.

pixi run mbio cloning gateway plan --help lists the rest: naming the donor, amplifying an insert with no att ends, which end a tag sits at, and which polymerase and strain the protocol names.

References¶

• Hartley, J.L., Temple, G.F. and Brasch, M.A. (2000) DNA cloning using in vitro site-specific recombination. Genome Research 10, 1788–1795.
• Brasch, M., Cheo, D., Hartley, J. and Temple, G., US 7,670,823 B1, FIG. 9, for the att site sequences.
• Invitrogen, Gateway Technology with Clonase II, MAN0000470, revised 2 April 2012.
• Invitrogen, Gateway BP Clonase II Enzyme Mix, product sheet 11789.II.pps, revision 31 October 2010.
• Invitrogen, Gateway LR Clonase II Enzyme Mix, MAN0001032 revision A.0.