{
  "title": "Gateway BP then LR: attB-GFP into pDEST-demo",
  "key": "76aa0fe526427748",
  "summary": "Recombine the 751 bp between attB-GFP's attB sites into pDONR-demo, giving the entry clone pDONR-demo-attB-GFP; grow that up and recombine it into pDEST-demo. Two staged reactions, each with its own incubation, stop, transformation and plate.",
  "overview": {
    "attB PCR": "775 bp product, 29 and 29 bp tails",
    "attB DNA": "attB-GFP, 751 bp insert",
    "Donor vector": "pDONR-demo, 661 bp",
    "Entry clone": "pDONR-demo-attB-GFP, 1037 bp",
    "Destination vector": "pDEST-demo, 473 bp",
    "Reaction": "BP then LR, 10 µL each at 25 °C",
    "Insert": "751 bp between the att sites",
    "Junctions": "attB1 and attB2",
    "Product": "pDEST-demo-GFP, 915 bp",
    "Selection": "ampicillin or carbenicillin"
  },
  "highlights": [
    "GFP carries no att site, so it is amplified onto attB ends first: each primer is a whole tail -- 4 G residues, the 25 bp att site and the frame bases this fusion needs, 29 bases forward and 29 reverse -- over an annealing region read off the insert's own end. The G residues leave with the BP by-product, so the entry clone is the same record as one made from an insert that arrived attB-flanked.",
    "BP runs first: the 751 bp between the attB sites move into pDONR-demo, making pDONR-demo-attB-GFP, which is picked, grown up and purified before LR takes it.",
    "LR then moves the 751 bp between the entry clone's att sites into the 164 bp of destination vector outside its own, and the ccdB cassette leaves with the by-product.",
    "The junction is not scarless: the clone gains a whole att site at each end of the insert, attB1 spelling ACAAGTTTGTACAAAAAAGCAGGCT and attB2 spelling ACCACTTTGTACAAGAAAGCTGGGT. A fusion reads through both.",
    "GFP reads on the same strand as T7 promoter, 8 bp downstream of it.",
    "There is a ribosome binding site annotated ahead of GFP, so the clone may make its protein."
  ],
  "background": [],
  "checks": [
    {
      "name": "primers",
      "status": "warn",
      "detail": "6 designed, 2 with a warning, 0 failing: GC on 2, hairpin on 1, longest run on 1; not judged: full-primer Tm, 3' end stability"
    },
    {
      "name": "BP junctions",
      "status": "pass",
      "detail": "attL1 at 136, attL2 at 878"
    },
    {
      "name": "BP att sites",
      "status": "pass",
      "detail": "the two the reaction wrote, and no other"
    },
    {
      "name": "LR junctions",
      "status": "pass",
      "detail": "attB1 at 89, attB2 at 831"
    },
    {
      "name": "LR att sites",
      "status": "pass",
      "detail": "the two the reaction wrote, and no other"
    },
    {
      "name": "insert att sites",
      "status": "pass",
      "detail": "no att site inside the 751 bp that move"
    },
    {
      "name": "ccdB host",
      "status": "pass",
      "detail": "CcdB kills TOP10 chemically competent E. coli, so unreacted vector and by-product do not grow"
    },
    {
      "name": "ccdB vector host",
      "status": null,
      "detail": "grow the donor and destination vectors in One Shot ccdB Survival 2 T1R, the only kind of strain that grows one"
    },
    {
      "name": "LR markers",
      "status": "pass",
      "detail": "ampicillin or carbenicillin on the expression clone, kanamycin on the entry clone, from the donor vector's KanR"
    }
  ],
  "choice": "",
  "consumes": [],
  "produces": [],
  "materials": [
    {
      "name": "attB-GFP primers",
      "supplier": "",
      "catalog": "",
      "storage": "-20 °C",
      "amount": "10 µM each",
      "note": "ordered off the oligo sheet on this page; HPLC- or PAGE-purified oligos are the published answer where colonies are few",
      "contains": [],
      "rules": [],
      "cautions": [],
      "citation": {
        "source": "MAN0000470",
        "locator": "pp. 43-44"
      }
    },
    {
      "name": "Q5 DNA Polymerase",
      "supplier": "",
      "catalog": "",
      "storage": "-20 °C",
      "amount": "",
      "note": "a hot-start enzyme is the published answer to an entry clone made of primer-dimers, so use one",
      "contains": [],
      "rules": [],
      "cautions": [],
      "citation": {
        "source": "MAN0000470",
        "locator": "pp. 43-44"
      }
    },
    {
      "name": "Monarch Spin PCR & DNA Cleanup Kit",
      "supplier": "New England Biolabs",
      "catalog": "T1130",
      "storage": "",
      "amount": "",
      "note": "",
      "contains": [],
      "rules": [],
      "cautions": [],
      "citation": null
    },
    {
      "name": "attB-GFP attB DNA",
      "supplier": "",
      "catalog": "",
      "storage": "-20 °C",
      "amount": "0.05 pmol (23.87 ng) per reaction",
      "note": "purified, which is what takes the attB primers and their dimers away",
      "contains": [],
      "rules": [],
      "cautions": [],
      "citation": null
    },
    {
      "name": "pDONR-demo donor vector",
      "supplier": "",
      "catalog": "",
      "storage": "-20 °C",
      "amount": "0.05 pmol (20.36 ng) per reaction",
      "note": "supercoiled, and grown in One Shot ccdB Survival 2 T1R",
      "contains": [],
      "rules": [],
      "cautions": [],
      "citation": null
    },
    {
      "name": "Gateway BP Clonase II enzyme mix",
      "supplier": "Invitrogen / Thermo Fisher",
      "catalog": "11789020",
      "storage": "-20 °C",
      "amount": "2 µL per reaction",
      "note": "thaw on ice and return it to the freezer at once",
      "contains": [],
      "rules": [],
      "cautions": [],
      "citation": null
    },
    {
      "name": "LB agar plates with kanamycin",
      "supplier": "",
      "catalog": "",
      "storage": "",
      "amount": "one plate per transformation",
      "note": "",
      "contains": [],
      "rules": [],
      "cautions": [],
      "citation": null
    },
    {
      "name": "pDONR-demo-attB-GFP entry clone",
      "supplier": "",
      "catalog": "",
      "storage": "-20 °C",
      "amount": "150 ng per reaction",
      "note": "the miniprep from the BP plate, which is what this reaction takes",
      "contains": [],
      "rules": [],
      "cautions": [],
      "citation": null
    },
    {
      "name": "pDEST-demo destination vector",
      "supplier": "",
      "catalog": "",
      "storage": "-20 °C",
      "amount": "150 ng per reaction",
      "note": "grown in One Shot ccdB Survival 2 T1R, which is the only kind of strain it grows in",
      "contains": [],
      "rules": [],
      "cautions": [],
      "citation": null
    },
    {
      "name": "Gateway LR Clonase II enzyme mix",
      "supplier": "Invitrogen / Thermo Fisher",
      "catalog": "11791020",
      "storage": "-20 °C",
      "amount": "2 µL per reaction",
      "note": "thaw on ice and return it to the freezer at once",
      "contains": [],
      "rules": [],
      "cautions": [],
      "citation": null
    },
    {
      "name": "TE buffer, pH 8.0",
      "supplier": "",
      "catalog": "",
      "storage": "",
      "amount": "to 8 µL per reaction",
      "note": "",
      "contains": [],
      "rules": [],
      "cautions": [],
      "citation": null
    },
    {
      "name": "Proteinase K solution",
      "supplier": "Invitrogen / Thermo Fisher",
      "catalog": "",
      "storage": "-20 °C",
      "amount": "1 µL per reaction",
      "note": "2 µg/µL, supplied with the enzyme mix",
      "contains": [],
      "rules": [],
      "cautions": [],
      "citation": null
    },
    {
      "name": "TOP10 chemically competent E. coli",
      "supplier": "",
      "catalog": "",
      "storage": "-80 °C",
      "amount": "50 µL per transformation",
      "note": "100,000,000 cfu/µg or better, and no F' episome",
      "contains": [],
      "rules": [],
      "cautions": [],
      "citation": null
    },
    {
      "name": "S.O.C. medium",
      "supplier": "",
      "catalog": "",
      "storage": "",
      "amount": "250 µL per transformation",
      "note": "",
      "contains": [],
      "rules": [],
      "cautions": [],
      "citation": null
    },
    {
      "name": "LB agar plates with ampicillin or carbenicillin",
      "supplier": "",
      "catalog": "",
      "storage": "",
      "amount": "one plate per transformation",
      "note": "",
      "contains": [],
      "rules": [],
      "cautions": [],
      "citation": null
    },
    {
      "name": "OneTaq Quick-Load 2X Master Mix with Standard Buffer",
      "supplier": "",
      "catalog": "M0486",
      "storage": "-20 °C",
      "amount": "12.5 µL per reaction",
      "note": "",
      "contains": [],
      "rules": [],
      "cautions": [],
      "citation": null
    },
    {
      "name": "Agarose, 1X TAE or TBE, and a DNA stain",
      "supplier": "",
      "catalog": "",
      "storage": "",
      "amount": "",
      "note": "",
      "contains": [],
      "rules": [],
      "cautions": [],
      "citation": null
    },
    {
      "name": "NEB 100 bp DNA Ladder",
      "supplier": "",
      "catalog": "N3231",
      "storage": "",
      "amount": "",
      "note": "",
      "contains": [],
      "rules": [],
      "cautions": [],
      "citation": {
        "source": "N3231",
        "locator": "band sizes"
      }
    },
    {
      "name": "Plasmid miniprep kit",
      "supplier": "",
      "catalog": "",
      "storage": "",
      "amount": "",
      "note": "for the entry clone the LR reaction takes, and for the clones that go to sequencing",
      "contains": [],
      "rules": [],
      "cautions": [],
      "citation": null
    }
  ],
  "oligos": [
    {
      "name": "attB-GFP forward",
      "sequence": "GGGGACAAGTTTGTACAAAAAAGCAGGCTATGAGTAAAGGAGAAGAACTTTTCAC",
      "purpose": "Amplify attB-GFP",
      "tm_c": 62.1,
      "stock": "10 µM",
      "note": "",
      "status": "warn",
      "checks": [
        {
          "name": "GC",
          "status": "warn",
          "detail": "35% (band 40-60)"
        },
        {
          "name": "longest run",
          "status": "warn",
          "detail": "6 (band 0-4)"
        }
      ]
    },
    {
      "name": "attB-GFP reverse",
      "sequence": "GGGGACCACTTTGTACAAGAAAGCTGGGTCTATTTGTATAGTTCATCCATGCCAT",
      "purpose": "Amplify attB-GFP",
      "tm_c": 62.0,
      "stock": "10 µM",
      "note": "",
      "status": "warn",
      "checks": [
        {
          "name": "GC",
          "status": "warn",
          "detail": "35% (band 40-60)"
        },
        {
          "name": "hairpin",
          "status": "warn",
          "detail": "55.7 °C (max 47)"
        }
      ]
    },
    {
      "name": "Colony PCR forward",
      "sequence": "AGGCTTGACCAATGCGTTCAGG",
      "purpose": "Screen colonies by PCR",
      "tm_c": 62.0,
      "stock": "10 µM",
      "note": "",
      "status": "pass",
      "checks": []
    },
    {
      "name": "Colony PCR reverse",
      "sequence": "ATAGCCTGATGACCTTAGCAGTTCATGGA",
      "purpose": "Screen colonies by PCR",
      "tm_c": 62.0,
      "stock": "10 µM",
      "note": "",
      "status": "pass",
      "checks": []
    },
    {
      "name": "Sequencing forward",
      "sequence": "GCTAAGGTCATCAGGCTATC",
      "purpose": "Confirm the clone by sequencing",
      "tm_c": 62.0,
      "stock": "10 µM",
      "note": "",
      "status": "pass",
      "checks": []
    },
    {
      "name": "Sequencing reverse",
      "sequence": "TCGTATTAAGCCTGAACGC",
      "purpose": "Confirm the clone by sequencing",
      "tm_c": 62.0,
      "stock": "10 µM",
      "note": "",
      "status": "pass",
      "checks": []
    }
  ],
  "order_sheet": "primers.tsv",
  "files": [
    "primers.tsv",
    "product.dna"
  ],
  "equipment": [
    "Spectrophotometer (NanoDrop) or fluorometer (Qubit)",
    "Water bath or heat block at 25 °C",
    "Water bath or heat block at 37 °C",
    "Heat block or water bath at 42 °C",
    "Shaking incubator and a plate incubator at 37 °C",
    "Thermocycler with a heated lid",
    "Agarose gel rig and power supply",
    "Microcentrifuge"
  ],
  "vessels": [],
  "plates": [],
  "steps": [
    {
      "title": "Amplify attB-GFP",
      "key": "pcr-attb-gfp",
      "section": "Make the fragments",
      "instructions": [
        "Thaw the buffer, dNTPs and primers on ice, then vortex and spin them down.",
        "Mix the master mix, dispense it into each tube, then add the GFP template.",
        "Run the program below: 63 °C annealing and 20 s extension for a 775 bp product."
      ],
      "cautions": [
        "Keep the polymerase on ice."
      ],
      "notes": [
        {
          "text": "Each primer carries a whole attB tail: 4 G residues, the 25 bp att site and the frame bases the fusion needs, 29 bases forward and 29 reverse. A tail short of that is a published cause of few or no colonies.",
          "citation": {
            "source": "MAN0000470",
            "locator": "pp. 43-44"
          }
        },
        "The annealing temperature above is read from the annealing regions alone; a tail pairs with nothing on the template in the first cycles.",
        {
          "text": "Over 70 bp of primer a two-step adapter PCR installs the same whole tail in two rounds; it is not planned here.",
          "citation": {
            "source": "MAN0000470",
            "locator": "pp. 47-48"
          }
        }
      ],
      "tables": [
        {
          "components": [
            {
              "name": "Q5 Reaction Buffer",
              "volume_ul": 10.0,
              "stock": "5X",
              "final": "1X",
              "master_mix": true,
              "citation": null,
              "calculator": null
            },
            {
              "name": "dNTP mix",
              "volume_ul": 1.0,
              "stock": "10 mM each",
              "final": "200 µM each",
              "master_mix": true,
              "citation": null,
              "calculator": null
            },
            {
              "name": "Forward primer",
              "volume_ul": 2.5,
              "stock": "10 µM",
              "final": "500 nM",
              "master_mix": true,
              "citation": null,
              "calculator": null
            },
            {
              "name": "Reverse primer",
              "volume_ul": 2.5,
              "stock": "10 µM",
              "final": "500 nM",
              "master_mix": true,
              "citation": null,
              "calculator": null
            },
            {
              "name": "Template DNA",
              "volume_ul": 1.0,
              "stock": "",
              "final": "",
              "master_mix": false,
              "citation": null,
              "calculator": null
            },
            {
              "name": "Q5 DNA Polymerase",
              "volume_ul": 0.5,
              "stock": "2 U/µL",
              "final": "1 unit",
              "master_mix": true,
              "citation": null,
              "calculator": null
            },
            {
              "name": "Nuclease-free water",
              "volume_ul": 32.5,
              "stock": "",
              "final": "to 50 µL",
              "master_mix": true,
              "citation": null,
              "calculator": null
            }
          ],
          "title": "attB-GFP PCR",
          "reactions": 1,
          "overage": 0.1
        }
      ],
      "programs": [
        {
          "stages": [
            {
              "incubations": [
                {
                  "label": "Initial denaturation",
                  "temperature_c": 98.0,
                  "seconds": 30,
                  "delta_c": null,
                  "citation": null
                }
              ],
              "cycles": 1,
              "citation": null
            },
            {
              "incubations": [
                {
                  "label": "Denature",
                  "temperature_c": 98.0,
                  "seconds": 10,
                  "delta_c": null,
                  "citation": null
                },
                {
                  "label": "Anneal",
                  "temperature_c": 63.0,
                  "seconds": 20,
                  "delta_c": null,
                  "citation": null
                },
                {
                  "label": "Extend",
                  "temperature_c": 72.0,
                  "seconds": 20,
                  "delta_c": null,
                  "citation": null
                }
              ],
              "cycles": 30,
              "citation": {
                "source": "M0491",
                "locator": "thermocycling conditions"
              }
            },
            {
              "incubations": [
                {
                  "label": "Final extension",
                  "temperature_c": 72.0,
                  "seconds": 120,
                  "delta_c": null,
                  "citation": null
                }
              ],
              "cycles": 1,
              "citation": null
            },
            {
              "incubations": [
                {
                  "label": "Hold",
                  "temperature_c": 4.0,
                  "seconds": null,
                  "delta_c": null,
                  "citation": null
                }
              ],
              "cycles": 1,
              "citation": null
            }
          ],
          "title": "attB-GFP PCR",
          "lid_temperature_c": null
        }
      ],
      "timers": [],
      "waits": [],
      "hands_on_seconds": null,
      "transfers": [],
      "figures": [],
      "gels": [],
      "expected": [
        "One band at 775 bp."
      ],
      "calculator": null,
      "troubleshooting": [
        {
          "problem": "No band",
          "solution": "Drop the annealing temperature by 3 °C and check the GFP template is there.",
          "citation": {
            "source": "M0491",
            "locator": "annealing temperature"
          }
        },
        {
          "problem": "Several bands",
          "solution": "Raise the annealing temperature, or gel-purify the band of the right size.",
          "citation": {
            "source": "M0491",
            "locator": "annealing temperature"
          }
        }
      ],
      "holes": []
    },
    {
      "title": "Purify every amplicon",
      "key": "purify-amplicons",
      "section": "Make the fragments",
      "instructions": [
        "Run each reaction over a Monarch Spin PCR & DNA Cleanup column and elute in the smallest volume the kit allows."
      ],
      "cautions": [],
      "notes": [
        {
          "text": "The BP reaction takes purified attB DNA: gel-purifying the product is the published fix for few or no colonies, and it takes the attB primers and their dimers away.",
          "citation": {
            "source": "MAN0000470",
            "locator": "pp. 43-44"
          }
        }
      ],
      "tables": [],
      "programs": [],
      "timers": [],
      "waits": [],
      "hands_on_seconds": null,
      "transfers": [],
      "figures": [],
      "gels": [],
      "expected": [
        "Clean DNA, free of polymerase, primers and dNTPs."
      ],
      "calculator": null,
      "troubleshooting": [
        {
          "problem": "Low recovery",
          "solution": "Elute in a larger volume and leave the buffer on the column longer.",
          "citation": {
            "source": "T1130",
            "locator": "troubleshooting, low DNA yield"
          }
        },
        {
          "problem": "An entry clone later runs as a 2.2 kb supercoiled plasmid",
          "solution": "The BP reaction cloned attB primer-dimers instead; gel-purify this product before running BP again.",
          "citation": {
            "source": "MAN0000470",
            "locator": "pp. 43-44"
          }
        }
      ],
      "holes": []
    },
    {
      "title": "Set up the BP reaction",
      "key": "set-up-bp",
      "section": "Make the entry clone",
      "instructions": [
        "Thaw the enzyme mix on ice and vortex it briefly twice.",
        "Pipette the attB DNA, the donor vector and the TE buffer into a tube at room temperature.",
        "Add 2 µL of Gateway BP Clonase II enzyme mix, mix well and spin down."
      ],
      "cautions": [
        {
          "text": "Do not go over 250 ng of donor vector or 500 ng of DNA altogether: excess DNA inhibits the reaction.",
          "citation": {
            "source": "MAN0000470",
            "locator": "p. 21"
          }
        }
      ],
      "notes": [
        "The volumes above take each DNA at the concentration the table assumes; pipette what your prep needs for the picomoles and make the difference up with TE buffer, pH 8.0.",
        {
          "text": "What is fixed is the picomoles and not the weight: 50 fmol of each, the attB DNA down to 20 fmol, weighed here from each record's own length.",
          "citation": {
            "source": "MAN0000470",
            "locator": "pp. 21-22"
          }
        },
        {
          "text": "A linear attB product and a supercoiled donor vector are the most efficient substrates for BP.",
          "citation": {
            "source": "11789",
            "locator": "p. 2"
          }
        }
      ],
      "tables": [
        {
          "components": [
            {
              "name": "attB-GFP",
              "volume_ul": 1.0,
              "stock": "",
              "final": "0.05 pmol (23.87 ng)",
              "master_mix": false,
              "citation": {
                "source": "NEBioCalculator",
                "locator": "dsDNA molecular weight"
              },
              "calculator": null
            },
            {
              "name": "pDONR-demo",
              "volume_ul": 1.0,
              "stock": "",
              "final": "0.05 pmol (20.36 ng)",
              "master_mix": false,
              "citation": {
                "source": "NEBioCalculator",
                "locator": "dsDNA molecular weight"
              },
              "calculator": null
            },
            {
              "name": "TE buffer, pH 8.0",
              "volume_ul": 6.0,
              "stock": "",
              "final": "to 8 µL",
              "master_mix": true,
              "citation": null,
              "calculator": null
            },
            {
              "name": "Gateway BP Clonase II enzyme mix",
              "volume_ul": 2.0,
              "stock": "",
              "final": "to 10 µL",
              "master_mix": true,
              "citation": {
                "source": "11789",
                "locator": "p. 3"
              },
              "calculator": null
            }
          ],
          "title": "BP reaction",
          "reactions": 1,
          "overage": 0.1
        }
      ],
      "programs": [],
      "timers": [],
      "waits": [],
      "hands_on_seconds": null,
      "transfers": [],
      "figures": [],
      "gels": [],
      "expected": [
        "A 10 µL reaction holding both DNAs."
      ],
      "calculator": null,
      "troubleshooting": [
        {
          "problem": "The DNA does not fit the reaction volume",
          "solution": "Concentrate either DNA, or scale the whole reaction up keeping the enzyme mix at its stated fraction of the volume.",
          "citation": null
        }
      ],
      "holes": []
    },
    {
      "title": "Run the BP reaction",
      "key": "run-bp",
      "section": "Make the entry clone",
      "instructions": [
        "Incubate at 25 °C for 1 hour."
      ],
      "cautions": [],
      "notes": [
        {
          "text": "An attB substrate of 5,000 bp or more runs up to 18 hours instead; efficiency falls as the DNA gets longer.",
          "citation": {
            "source": "MAN0000470",
            "locator": "p. 23"
          }
        },
        {
          "text": "Each att site is named by matching its 25 bp recombination region to that site's published sequence.",
          "citation": {
            "source": "US7670823",
            "locator": "FIG. 9"
          }
        },
        "Junction positions are 1-based, on the entry clone."
      ],
      "tables": [],
      "programs": [],
      "timers": [
        {
          "label": "BP incubation",
          "seconds": 3600
        }
      ],
      "waits": [],
      "hands_on_seconds": null,
      "transfers": [],
      "figures": [
        {
          "records": [
            "entry-clone.dna"
          ],
          "caption": "The entry clone the reaction makes: attL1 and attL2, the sites it writes where the two molecules crossed over.",
          "span": null,
          "linear": false,
          "sequence_view": false,
          "enzymes": [],
          "highlight": [
            "attL1",
            "attL2"
          ],
          "citation": null
        }
      ],
      "gels": [],
      "expected": [
        "Nothing visible: the reaction is a recombination, not a digest.",
        "The entry clone carries attL1 at 136, spelling CCAACTTTGTACAAAAAAGCAGGCT: its first bases from pDONR-demo and the rest from attB-GFP.",
        "The entry clone carries attL2 at 878, spelling CCAACTTTGTACAAGAAAGCTGGGT: its first bases from pDONR-demo and the rest from attB-GFP."
      ],
      "calculator": null,
      "troubleshooting": [
        {
          "problem": "Few or no colonies later, though the transformation control worked",
          "solution": "Use an attB substrate with a donor vector (attP): the BP reaction takes those and no others. Do not freeze and thaw the enzyme mix more than ten times.",
          "citation": {
            "source": "MAN0000470",
            "locator": "p. 40"
          }
        }
      ],
      "holes": []
    },
    {
      "title": "Stop the BP reaction with proteinase K",
      "key": "stop-bp",
      "section": "Make the entry clone",
      "instructions": [
        "Add 1 µL of proteinase K at 2 µg/µL.",
        "Incubate at 37 °C for 10 minutes."
      ],
      "cautions": [],
      "notes": [
        {
          "text": "An untreated reaction is a published cause of few or no colonies, so this step is not optional.",
          "citation": {
            "source": "MAN0000470",
            "locator": "p. 40"
          }
        }
      ],
      "tables": [],
      "programs": [],
      "timers": [
        {
          "label": "Proteinase K, BP",
          "seconds": 600
        }
      ],
      "waits": [],
      "hands_on_seconds": null,
      "transfers": [],
      "figures": [],
      "gels": [],
      "expected": [
        "A reaction that can go straight into competent cells."
      ],
      "calculator": null,
      "troubleshooting": [],
      "holes": []
    },
    {
      "title": "Transform and plate the BP reaction",
      "key": "transform-bp",
      "section": "Make the entry clone",
      "instructions": [
        "Thaw 50 µL of TOP10 chemically competent E. coli on ice.",
        "Add 1 µL of the BP reaction and flick the tube four or five times.",
        "Hold on ice for 30 minutes.",
        "Heat shock at 42 °C for 30 seconds.",
        "Return to ice for 2 minutes.",
        "Add 250 µL of outgrowth medium and shake at 37 °C for 60 minutes at 250 rpm.",
        "Spread 100 µL of a 1:10 dilution on a warmed plate and grow overnight at 37 °C."
      ],
      "cautions": [
        "Competent cells die if they warm up; keep them on ice until the shock."
      ],
      "notes": [
        "Colour does not report this insertion; screen every colony by PCR.",
        "The clone is not expected to make GFP: no ribosome binding site is annotated ahead of it.",
        "Unreacted donor vector and the by-product both keep the ccdB gene, which kills TOP10 chemically competent E. coli, so they do not grow. A strain carrying F' would supply ccdA and cancel that.",
        {
          "text": "No manual states what fraction of the colonies is correct; the one count published found 195 of 197 correct after BP.",
          "citation": {
            "source": "hartley-2000",
            "locator": "Results"
          }
        }
      ],
      "tables": [],
      "programs": [],
      "timers": [
        {
          "label": "On ice",
          "seconds": 1800
        },
        {
          "label": "Heat shock",
          "seconds": 30
        },
        {
          "label": "Back on ice",
          "seconds": 120
        },
        {
          "label": "Outgrowth",
          "seconds": 3600
        }
      ],
      "waits": [],
      "hands_on_seconds": null,
      "transfers": [],
      "figures": [],
      "gels": [],
      "expected": [
        "More than 1,500 colonies where the whole reaction is transformed and plated, with cells at 100,000,000 cfu/µg or better."
      ],
      "calculator": null,
      "troubleshooting": [
        {
          "problem": "No colonies",
          "solution": "Check the antibiotic and the cells' efficiency, and plate the rest of the outgrowth.",
          "citation": {
            "source": "NEB-cloning",
            "locator": "few or no transformants"
          }
        },
        {
          "problem": "A lawn",
          "solution": "Plate a smaller volume or a greater dilution next time.",
          "citation": null
        },
        {
          "problem": "Two sizes of colony on the plate",
          "solution": "The donor vector's ccdB gene has mutated or been deleted; the negative control then gives a similar count.",
          "citation": {
            "source": "MAN0000470",
            "locator": "p. 41"
          }
        }
      ],
      "holes": []
    },
    {
      "title": "Pick and miniprep the entry clone",
      "key": "miniprep-entry-clone",
      "section": "Make the entry clone",
      "instructions": [
        "Pick single colonies into overnight cultures on the plate's own antibiotic.",
        "Miniprep each culture and measure what it yielded.",
        "Take 50-150 ng of one prep into the LR reaction below."
      ],
      "cautions": [],
      "notes": [
        "The LR reaction takes purified entry clone and not the stopped BP reaction: 50-150 ng is a weight of miniprep DNA, and no plan can weigh a yield nobody has measured yet.",
        {
          "text": "Supercoiled miniprep DNA is the most efficient substrate for LR.",
          "citation": {
            "source": "MAN0001032",
            "locator": "p. 2"
          }
        },
        {
          "text": "The one-tube protocol chains the two reactions without this step and gives at least 10-20% of the expression clones the staged route gives, each of which it says to sequence. It runs on its own timings and is not the protocol below.",
          "citation": {
            "source": "MAN0000470",
            "locator": "pp. 45-46"
          }
        }
      ],
      "tables": [],
      "programs": [],
      "timers": [],
      "waits": [],
      "hands_on_seconds": null,
      "transfers": [],
      "figures": [],
      "gels": [],
      "expected": [
        "Supercoiled pDONR-demo-attB-GFP, concentrated enough to weigh 150 ng into the volume the LR table leaves for it."
      ],
      "calculator": null,
      "troubleshooting": [
        {
          "problem": "The prep is too dilute for the reaction",
          "solution": "Concentrate it, or pipette more of it and less TE buffer.",
          "citation": null
        },
        {
          "problem": "The prep runs as a 2.2 kb supercoiled plasmid",
          "solution": "That size is a BP reaction that cloned attB primer-dimers. Gel-purify the attB DNA and amplify it with a hot-start polymerase before running BP again.",
          "citation": {
            "source": "MAN0000470",
            "locator": "pp. 43-44"
          }
        }
      ],
      "holes": []
    },
    {
      "title": "Set up the LR reaction",
      "key": "set-up-lr",
      "section": "Recombine",
      "instructions": [
        "Thaw the enzyme mix on ice and vortex it briefly twice.",
        "Pipette the two plasmids and the TE buffer into a tube at room temperature.",
        "Add 2 µL of Gateway LR Clonase II enzyme mix, mix well and spin down."
      ],
      "cautions": [
        {
          "text": "Do not go over 150 ng of entry clone.",
          "citation": {
            "source": "MAN0001032",
            "locator": "p. 2"
          }
        }
      ],
      "notes": [
        "The volumes above take each DNA at the concentration the table assumes; pipette what your prep needs for the nanograms and make the difference up with TE buffer, pH 8.0.",
        {
          "text": "Above 150 ng of entry clone the colonies carry several molecules, and below 50 ng there are fewer of them.",
          "citation": {
            "source": "MAN0001032",
            "locator": "p. 2"
          }
        },
        {
          "text": "Supercoiled plasmids are the most efficient substrates for LR.",
          "citation": {
            "source": "MAN0001032",
            "locator": "p. 2"
          }
        }
      ],
      "tables": [
        {
          "components": [
            {
              "name": "pDONR-demo-attB-GFP",
              "volume_ul": 1.0,
              "stock": "",
              "final": "0.235 pmol (150 ng)",
              "master_mix": false,
              "citation": {
                "source": "NEBioCalculator",
                "locator": "dsDNA molecular weight"
              },
              "calculator": null
            },
            {
              "name": "pDEST-demo",
              "volume_ul": 1.0,
              "stock": "",
              "final": "0.515 pmol (150 ng)",
              "master_mix": false,
              "citation": {
                "source": "NEBioCalculator",
                "locator": "dsDNA molecular weight"
              },
              "calculator": null
            },
            {
              "name": "TE buffer, pH 8.0",
              "volume_ul": 6.0,
              "stock": "",
              "final": "to 8 µL",
              "master_mix": true,
              "citation": null,
              "calculator": null
            },
            {
              "name": "Gateway LR Clonase II enzyme mix",
              "volume_ul": 2.0,
              "stock": "",
              "final": "to 10 µL",
              "master_mix": true,
              "citation": {
                "source": "MAN0001032",
                "locator": "p. 3"
              },
              "calculator": null
            }
          ],
          "title": "LR reaction",
          "reactions": 1,
          "overage": 0.1
        }
      ],
      "programs": [],
      "timers": [],
      "waits": [],
      "hands_on_seconds": null,
      "transfers": [],
      "figures": [],
      "gels": [],
      "expected": [
        "A 10 µL reaction holding both plasmids."
      ],
      "calculator": null,
      "troubleshooting": [
        {
          "problem": "The DNA does not fit the reaction volume",
          "solution": "Concentrate either DNA, or scale the whole reaction up keeping the enzyme mix at its stated fraction of the volume.",
          "citation": null
        }
      ],
      "holes": []
    },
    {
      "title": "Run the LR reaction",
      "key": "run-lr",
      "section": "Recombine",
      "instructions": [
        "Incubate at 25 °C for 1 hour."
      ],
      "cautions": [],
      "notes": [
        {
          "text": "A plasmid of 10,000 bp or more runs up to 18 hours instead; efficiency falls as the DNA gets longer.",
          "citation": {
            "source": "MAN0000470",
            "locator": "p. 32"
          }
        },
        {
          "text": "Each att site is named by matching its 25 bp recombination region to that site's published sequence.",
          "citation": {
            "source": "US7670823",
            "locator": "FIG. 9"
          }
        },
        "Junction positions are 1-based, on the expression clone."
      ],
      "tables": [],
      "programs": [],
      "timers": [
        {
          "label": "LR incubation",
          "seconds": 3600
        }
      ],
      "waits": [],
      "hands_on_seconds": null,
      "transfers": [],
      "figures": [
        {
          "records": [
            "product.dna"
          ],
          "caption": "The expression clone the reaction makes: attB1 and attB2, the sites it writes where the two molecules crossed over.",
          "span": null,
          "linear": false,
          "sequence_view": false,
          "enzymes": [],
          "highlight": [
            "attB1",
            "attB2"
          ],
          "citation": null
        }
      ],
      "gels": [],
      "expected": [
        "Nothing visible: the reaction is a recombination, not a digest.",
        "The expression clone carries attB1 at 89, spelling ACAAGTTTGTACAAAAAAGCAGGCT: its first bases from pDEST-demo and the rest from pDONR-demo-attB-GFP.",
        "The expression clone carries attB2 at 831, spelling ACCACTTTGTACAAGAAAGCTGGGT: its first bases from pDEST-demo and the rest from pDONR-demo-attB-GFP."
      ],
      "calculator": null,
      "troubleshooting": [
        {
          "problem": "Few or no colonies later, though the transformation control worked",
          "solution": "Use an entry clone (attL) with a destination vector (attR): the LR reaction takes those and no others. Do not freeze and thaw the enzyme mix more than ten times.",
          "citation": {
            "source": "MAN0000470",
            "locator": "p. 40"
          }
        }
      ],
      "holes": []
    },
    {
      "title": "Stop the LR reaction with proteinase K",
      "key": "stop-lr",
      "section": "Recombine",
      "instructions": [
        "Add 1 µL of proteinase K at 2 µg/µL.",
        "Incubate at 37 °C for 10 minutes."
      ],
      "cautions": [],
      "notes": [
        {
          "text": "An untreated reaction is a published cause of few or no colonies, so this step is not optional.",
          "citation": {
            "source": "MAN0000470",
            "locator": "p. 40"
          }
        }
      ],
      "tables": [],
      "programs": [],
      "timers": [
        {
          "label": "Proteinase K, LR",
          "seconds": 600
        }
      ],
      "waits": [],
      "hands_on_seconds": null,
      "transfers": [],
      "figures": [],
      "gels": [],
      "expected": [
        "A reaction that can go straight into competent cells."
      ],
      "calculator": null,
      "troubleshooting": [],
      "holes": []
    },
    {
      "title": "Transform and plate the LR reaction",
      "key": "transform-lr",
      "section": "Transform and screen",
      "instructions": [
        "Thaw 50 µL of TOP10 chemically competent E. coli on ice.",
        "Add 1 µL of the LR reaction and flick the tube four or five times.",
        "Hold on ice for 30 minutes.",
        "Heat shock at 42 °C for 30 seconds.",
        "Return to ice for 2 minutes.",
        "Add 250 µL of outgrowth medium and shake at 37 °C for 60 minutes at 250 rpm.",
        "Spread 100 µL of a 1:10 dilution on a warmed plate and grow overnight at 37 °C."
      ],
      "cautions": [
        "Competent cells die if they warm up; keep them on ice until the shock."
      ],
      "notes": [
        "Colour does not report this insertion; screen every colony by PCR.",
        "Unreacted destination vector and the by-product both keep the ccdB gene, which kills TOP10 chemically competent E. coli, so they do not grow. A strain carrying F' would supply ccdA and cancel that.",
        {
          "text": "No manual states what fraction of the colonies is correct; the one count published found 96 of 102 correct after LR.",
          "citation": {
            "source": "hartley-2000",
            "locator": "Results"
          }
        },
        "The expression clone lost the chloramphenicol cassette with the by-product, so restreaking a colony on 30 µg/mL chloramphenicol confirms it: a true expression clone does not grow there, and one carrying a mutated ccdB gene does."
      ],
      "tables": [],
      "programs": [],
      "timers": [
        {
          "label": "On ice",
          "seconds": 1800
        },
        {
          "label": "Heat shock",
          "seconds": 30
        },
        {
          "label": "Back on ice",
          "seconds": 120
        },
        {
          "label": "Outgrowth",
          "seconds": 3600
        }
      ],
      "waits": [],
      "hands_on_seconds": null,
      "transfers": [],
      "figures": [],
      "gels": [],
      "expected": [
        "More than 5,000 colonies where the whole reaction is transformed and plated, with cells at 100,000,000 cfu/µg or better."
      ],
      "calculator": null,
      "troubleshooting": [
        {
          "problem": "No colonies",
          "solution": "Check the antibiotic and the cells' efficiency, and plate the rest of the outgrowth.",
          "citation": {
            "source": "NEB-cloning",
            "locator": "few or no transformants"
          }
        },
        {
          "problem": "A lawn",
          "solution": "Plate a smaller volume or a greater dilution next time.",
          "citation": null
        },
        {
          "problem": "Small colonies beside large ones",
          "solution": "Usually unreacted pDONR-demo-attB-GFP co-transforming; restreak them on the entry clone's own antibiotic to tell.",
          "citation": {
            "source": "MAN0000470",
            "locator": "p. 41"
          }
        }
      ],
      "holes": []
    },
    {
      "title": "Screen colonies by PCR",
      "key": "colony-pcr",
      "section": "Transform and screen",
      "instructions": [
        "Touch a well-separated colony with a sterile toothpick and stir it into the tube until the liquid clouds.",
        "Streak the same toothpick onto a numbered plate, so the clone survives the PCR.",
        "Run the program below and load 5 µL on a 2% gel."
      ],
      "cautions": [],
      "notes": [
        "The long first step at 94 °C lyses the cells; there is no purified template.",
        "Both primers sit in the destination vector's backbone, so one product crosses both attB junctions and an unrecombined vector gives a band of its own.",
        "An unrecombined destination vector still carries ccdB, which kills TOP10 chemically competent E. coli, so its lane is what a strain supplying ccdA or a damaged ccdB gene would put on the plate.",
        {
          "text": "A restriction digest beside this screen is recommended the first time it is run: mispriming and contaminating template both give artefacts.",
          "citation": {
            "source": "MAN0000291",
            "locator": "p. 10"
          }
        }
      ],
      "tables": [
        {
          "components": [
            {
              "name": "OneTaq Quick-Load 2X Master Mix with Standard Buffer (M0486)",
              "volume_ul": 12.5,
              "stock": "2X",
              "final": "1X",
              "master_mix": true,
              "citation": null,
              "calculator": null
            },
            {
              "name": "Forward primer",
              "volume_ul": 0.5,
              "stock": "10 µM",
              "final": "200 nM",
              "master_mix": true,
              "citation": null,
              "calculator": null
            },
            {
              "name": "Reverse primer",
              "volume_ul": 0.5,
              "stock": "10 µM",
              "final": "200 nM",
              "master_mix": true,
              "citation": null,
              "calculator": null
            },
            {
              "name": "Nuclease-free water",
              "volume_ul": 11.5,
              "stock": "",
              "final": "to 25 µL",
              "master_mix": true,
              "citation": null,
              "calculator": null
            }
          ],
          "title": "Colony PCR",
          "reactions": 1,
          "overage": 0.1
        }
      ],
      "programs": [
        {
          "stages": [
            {
              "incubations": [
                {
                  "label": "Lysis",
                  "temperature_c": 94.0,
                  "seconds": 300,
                  "delta_c": null,
                  "citation": null
                }
              ],
              "cycles": 1,
              "citation": null
            },
            {
              "incubations": [
                {
                  "label": "Denature",
                  "temperature_c": 94.0,
                  "seconds": 30,
                  "delta_c": null,
                  "citation": null
                },
                {
                  "label": "Anneal",
                  "temperature_c": 57.0,
                  "seconds": 30,
                  "delta_c": null,
                  "citation": null
                },
                {
                  "label": "Extend",
                  "temperature_c": 68.0,
                  "seconds": 60,
                  "delta_c": null,
                  "citation": null
                }
              ],
              "cycles": 30,
              "citation": {
                "source": "M0480",
                "locator": "thermocycling conditions"
              }
            },
            {
              "incubations": [
                {
                  "label": "Final extension",
                  "temperature_c": 68.0,
                  "seconds": 300,
                  "delta_c": null,
                  "citation": null
                }
              ],
              "cycles": 1,
              "citation": null
            },
            {
              "incubations": [
                {
                  "label": "Hold",
                  "temperature_c": 10.0,
                  "seconds": null,
                  "delta_c": null,
                  "citation": null
                }
              ],
              "cycles": 1,
              "citation": null
            }
          ],
          "title": "Colony PCR",
          "lid_temperature_c": null
        }
      ],
      "timers": [],
      "waits": [],
      "hands_on_seconds": null,
      "transfers": [],
      "figures": [],
      "gels": [
        {
          "ladder": {
            "name": "NEB 100 bp DNA Ladder (N3231)",
            "bands_bp": [
              100,
              200,
              300,
              400,
              500,
              600,
              700,
              800,
              900,
              1000,
              1200,
              1517
            ]
          },
          "lanes": [
            {
              "label": "Correct clone",
              "bands_bp": [
                871
              ]
            },
            {
              "label": "Empty vector",
              "bands_bp": [
                429
              ]
            }
          ],
          "title": "Colony PCR"
        }
      ],
      "expected": [
        "Each of the 2 junctions is read: the flanking pair crosses them all.",
        "Correct clone: 871 bp.",
        "Empty vector: 429 bp."
      ],
      "calculator": null,
      "troubleshooting": [
        {
          "problem": "No band in any lane",
          "solution": "The colony was too much material: touch a smaller one, or dilute it.",
          "citation": {
            "source": "colony-pcr",
            "locator": "template"
          }
        },
        {
          "problem": "The plate carries large colonies and small ones",
          "solution": "The small ones are usually unreacted pDONR-demo-attB-GFP co-transforming. It carries neither of these primers, so it adds no band here; restreak on the entry clone's own antibiotic to tell.",
          "citation": {
            "source": "MAN0000470",
            "locator": "p. 41"
          }
        }
      ],
      "holes": []
    },
    {
      "title": "Confirm the clone by sequencing",
      "key": "sequencing",
      "section": "Transform and screen",
      "instructions": [
        "Miniprep two or three colonies that read as correct.",
        "Send each miniprep with both sequencing primers.",
        "Send at least 500 ng of plasmid with 5-50 pmol of each primer.",
        "Check each read against product.dna; keep a clone only when every junction and insert reads true."
      ],
      "cautions": [],
      "notes": [
        "Only a read across the junctions confirms the assembly, whatever the screen said.",
        "A provider whose read is shorter than the lengths above needs a further primer inside the inserts.",
        {
          "text": "No kit primer reads these junctions: GW1 and GW2 suit pCR8/GW/TOPO alone, and an M13 primer crosses at least 130 bp of vector first. Both primers above are designed against this record.",
          "citation": {
            "source": "MAN0000437",
            "locator": "p. 13"
          }
        }
      ],
      "tables": [],
      "programs": [],
      "timers": [],
      "waits": [],
      "hands_on_seconds": null,
      "transfers": [],
      "figures": [],
      "gels": [],
      "expected": [
        "Sequencing forward anneals 103 bp from its own junction and has to read 854 bp to cover the far one.",
        "Sequencing reverse anneals 117 bp from its own junction and has to read 868 bp to cover the far one.",
        "The junctions read as ACAAGTTTGTACAAAAAAGCAGGCT and ACCACTTTGTACAAGAAAGCTGGGT, and the parts match pDONR-demo-attB-GFP."
      ],
      "calculator": null,
      "troubleshooting": [
        {
          "problem": "The read starts too close to the junction",
          "solution": "Move the primer further out; the first bases after a primer are unreadable.",
          "citation": {
            "source": "genewiz-sanger",
            "locator": "sequencing primer design"
          }
        }
      ],
      "holes": []
    }
  ],
  "sources": {
    "NEBioCalculator": {
      "document": "New England Biolabs NEBioCalculator",
      "edition": "script main-6f3020c533.js, capture 2026-08-28",
      "url": "",
      "read_as": "Wayback Machine",
      "date": "",
      "note": "docs/research/primer-design-and-pcr.md"
    },
    "N3231": {
      "document": "New England Biolabs #N3231 100 bp DNA Ladder product page",
      "edition": "capture 2025-10-31",
      "url": "",
      "read_as": "Wayback Machine",
      "date": "",
      "note": "docs/research/primer-design-and-pcr.md"
    },
    "T1130": {
      "document": "New England Biolabs #T1130 Monarch Spin PCR & DNA Cleanup Kit instruction manual",
      "edition": "version 1.0 06.24",
      "url": "",
      "read_as": "",
      "date": "2026-09-18",
      "note": "docs/research/restriction-ligation.md"
    },
    "M0491": {
      "document": "New England Biolabs #M0491 Q5 High-Fidelity DNA Polymerase protocol page",
      "edition": "capture 2024-08-04",
      "url": "",
      "read_as": "Wayback Machine",
      "date": "2026-09-12",
      "note": ""
    },
    "NEB-cloning": {
      "document": "New England Biolabs, Troubleshooting Guide for Cloning",
      "edition": "",
      "url": "https://www.neb.com/en-us/tools-and-resources/troubleshooting-guides/troubleshooting-guide-for-cloning",
      "read_as": "",
      "date": "2026-09-18",
      "note": "docs/research/restriction-ligation.md"
    },
    "colony-pcr": {
      "document": "New England Biolabs application note, Robust Colony PCR from Multiple E. coli Strains using OneTaq Quick-Load Master Mixes",
      "edition": "Y. Xu, 11/13",
      "url": "",
      "read_as": "",
      "date": "2026-09-12",
      "note": "docs/research/primer-design-and-pcr.md"
    },
    "genewiz-sanger": {
      "document": "Azenta/Genewiz, Sanger sequencing FAQ and technical notes",
      "edition": "",
      "url": "",
      "read_as": "",
      "date": "2026-09-12",
      "note": "docs/research/primer-design-and-pcr.md"
    },
    "M0480": {
      "document": "New England Biolabs #M0480 OneTaq DNA Polymerase protocol",
      "edition": "protocols.io version 2, 2022-02-21",
      "url": "https://dx.doi.org/10.17504/protocols.io.bd24i8gw",
      "read_as": "",
      "date": "2026-09-12",
      "note": ""
    },
    "11789": {
      "document": "Thermo Fisher Scientific Gateway BP Clonase II enzyme mix product sheet",
      "edition": "11789.II.pps, revision 31 October 2010",
      "url": "",
      "read_as": "",
      "date": "2026-09-18",
      "note": "docs/research/gateway-cloning.md"
    },
    "MAN0000470": {
      "document": "Thermo Fisher Scientific #MAN0000470 Gateway Technology with Clonase II user guide",
      "edition": "part 25-0749, revision 2 April 2012",
      "url": "",
      "read_as": "",
      "date": "2026-09-18",
      "note": "docs/research/gateway-cloning.md"
    },
    "MAN0001032": {
      "document": "Thermo Fisher Scientific #MAN0001032 Gateway LR Clonase II enzyme mix product sheet",
      "edition": "revision A.0",
      "url": "",
      "read_as": "",
      "date": "2026-09-18",
      "note": "docs/research/gateway-cloning.md"
    },
    "MAN0000291": {
      "document": "Thermo Fisher Scientific #MAN0000291 Gateway pDONR Vectors user guide",
      "edition": "part 25-0531, revised 29 March 2012",
      "url": "",
      "read_as": "",
      "date": "2026-09-18",
      "note": "docs/research/gateway-cloning.md"
    },
    "MAN0000437": {
      "document": "Thermo Fisher Scientific #MAN0000437 pCR8/GW/TOPO TA Cloning Kit user guide",
      "edition": "part 25-0706, revised 23 March 2012",
      "url": "",
      "read_as": "",
      "date": "2026-09-18",
      "note": "docs/research/gateway-cloning.md"
    },
    "hartley-2000": {
      "document": "Hartley, J.L., Temple, G.F. and Brasch, M.A. (2000) DNA cloning using in vitro site-specific recombination. Genome Res. 10, 1788-1795",
      "edition": "",
      "url": "https://doi.org/10.1101/gr.143000",
      "read_as": "",
      "date": "",
      "note": "docs/research/gateway-cloning.md"
    },
    "US7670823": {
      "document": "Brasch, M., Cheo, D., Hartley, J. and Temple, G., US 7,670,823 B1",
      "edition": "",
      "url": "https://patents.google.com/patent/US7670823B1/en",
      "read_as": "",
      "date": "",
      "note": "docs/research/gateway-cloning.md"
    }
  },
  "holes": [],
  "bill": null
}