Gateway BP then LR: attB-GFP into pDEST-demo

Recombine the 751 bp between attB-GFP's attB sites into pDONR-demo, giving the entry clone pDONR-demo-attB-GFP; grow that up and recombine it into pDEST-demo. Two staged reactions, each with its own incubation, stop, transformation and plate.

attB PCR: 775 bp product, 29 and 29 bp tails
attB DNA: attB-GFP, 751 bp insert
Donor vector: pDONR-demo, 661 bp
Entry clone: pDONR-demo-attB-GFP, 1037 bp
Destination vector: pDEST-demo, 473 bp
Reaction: BP then LR, 10 µL each at 25 °C
Insert: 751 bp between the att sites
Junctions: attB1 and attB2
Product: pDEST-demo-GFP, 915 bp
Selection: ampicillin or carbenicillin

Keep in mind

GFP carries no att site, so it is amplified onto attB ends first: each primer is a whole tail -- 4 G residues, the 25 bp att site and the frame bases this fusion needs, 29 bases forward and 29 reverse -- over an annealing region read off the insert's own end. The G residues leave with the BP by-product, so the entry clone is the same record as one made from an insert that arrived attB-flanked.

BP runs first: the 751 bp between the attB sites move into pDONR-demo, making pDONR-demo-attB-GFP, which is picked, grown up and purified before LR takes it.

LR then moves the 751 bp between the entry clone's att sites into the 164 bp of destination vector outside its own, and the ccdB cassette leaves with the by-product.

The junction is not scarless: the clone gains a whole att site at each end of the insert, attB1 spelling ACAAGTTTGTACAAAAAAGCAGGCT and attB2 spelling ACCACTTTGTACAAGAAAGCTGGGT. A fusion reads through both.

GFP reads on the same strand as T7 promoter, 8 bp downstream of it.

There is a ribosome binding site annotated ahead of GFP, so the clone may make its protein.

primerswarn
BP junctionspass
BP att sitespass
LR junctionspass
LR att sitespass
insert att sitespass
ccdB hostpass
ccdB vector hostnot judged
LR markerspass

primers warn: 6 designed, 2 with a warning, 0 failing: GC on 2, hairpin on 1, longest run on 1; not judged: full-primer Tm, 3' end stability

ccdB vector host not judged: grow the donor and destination vectors in One Shot ccdB Survival 2 T1R, the only kind of strain that grows one

Materials

Name	Supplier	Catalogue	Storage	Per run	Note	Source
attB-GFP primers			-20 °C	10 µM each	ordered off the oligo sheet on this page; HPLC- or PAGE-purified oligos are the published answer where colonies are few	^[1]
Q5 DNA Polymerase			-20 °C		a hot-start enzyme is the published answer to an entry clone made of primer-dimers, so use one	^[1]
Monarch Spin PCR & DNA Cleanup Kit	New England Biolabs	T1130
attB-GFP attB DNA			-20 °C	0.05 pmol (23.87 ng) per reaction	purified, which is what takes the attB primers and their dimers away
pDONR-demo donor vector			-20 °C	0.05 pmol (20.36 ng) per reaction	supercoiled, and grown in One Shot ccdB Survival 2 T1R
Gateway BP Clonase II enzyme mix	Invitrogen / Thermo Fisher	11789020	-20 °C	2 µL per reaction	thaw on ice and return it to the freezer at once
LB agar plates with kanamycin				one plate per transformation
pDONR-demo-attB-GFP entry clone			-20 °C	150 ng per reaction	the miniprep from the BP plate, which is what this reaction takes
pDEST-demo destination vector			-20 °C	150 ng per reaction	grown in One Shot ccdB Survival 2 T1R, which is the only kind of strain it grows in
Gateway LR Clonase II enzyme mix	Invitrogen / Thermo Fisher	11791020	-20 °C	2 µL per reaction	thaw on ice and return it to the freezer at once
TE buffer, pH 8.0				to 8 µL per reaction
Proteinase K solution	Invitrogen / Thermo Fisher		-20 °C	1 µL per reaction	2 µg/µL, supplied with the enzyme mix
TOP10 chemically competent E. coli			-80 °C	50 µL per transformation	100,000,000 cfu/µg or better, and no F' episome
S.O.C. medium				250 µL per transformation
LB agar plates with ampicillin or carbenicillin				one plate per transformation
OneTaq Quick-Load 2X Master Mix with Standard Buffer		M0486	-20 °C	12.5 µL per reaction
Agarose, 1X TAE or TBE, and a DNA stain
NEB 100 bp DNA Ladder		N3231				^[2]
Plasmid miniprep kit					for the entry clone the LR reaction takes, and for the clones that go to sequencing

Equipment: Spectrophotometer (NanoDrop) or fluorometer (Qubit), Water bath or heat block at 25 °C, Water bath or heat block at 37 °C, Heat block or water bath at 42 °C, Shaking incubator and a plate incubator at 37 °C, Thermocycler with a heated lid, Agarose gel rig and power supply, Microcentrifuge

Oligos

Order sheet: primers.tsv

Name	Sequence (5'→3')	Length	Tm (°C)	For	Working stock	Checks
attB-GFP forward	`GGGGACAAGTTTGTACAAAAAAGCAGGCTATGAGTAAAGGAGAAGAACTTTTCAC`	55	62.1	Amplify attB-GFP	10 µM	warn
attB-GFP reverse	`GGGGACCACTTTGTACAAGAAAGCTGGGTCTATTTGTATAGTTCATCCATGCCAT`	55	62.0	Amplify attB-GFP	10 µM	warn
Colony PCR forward	`AGGCTTGACCAATGCGTTCAGG`	22	62.0	Screen colonies by PCR	10 µM	pass
Colony PCR reverse	`ATAGCCTGATGACCTTAGCAGTTCATGGA`	29	62.0	Screen colonies by PCR	10 µM	pass
Sequencing forward	`GCTAAGGTCATCAGGCTATC`	20	62.0	Confirm the clone by sequencing	10 µM	pass
Sequencing reverse	`TCGTATTAAGCCTGAACGC`	19	62.0	Confirm the clone by sequencing	10 µM	pass

Checks on 2 of 6 oligos

attB-GFP forward warn: GC 35% (band 40-60), longest run 6 (band 0-4)
attB-GFP reverse warn: GC 35% (band 40-60), hairpin 55.7 °C (max 47)

Make the fragments

1Amplify attB-GFP

Caution: Keep the polymerase on ice.

Thaw the buffer, dNTPs and primers on ice, then vortex and spin them down.
Mix the master mix, dispense it into each tube, then add the GFP template.
Run the program below: 63 °C annealing and 20 s extension for a 775 bp product.

attB-GFP PCR

Reactions mix includes 10% extra

Component	Stock	Final	1 rxn (µL)	Mix for 1 (µL)
Q5 Reaction Buffer	5X	1X	10	11
dNTP mix	10 mM each	200 µM each	1	1.1
Forward primer	10 µM	500 nM	2.5	2.75
Reverse primer	10 µM	500 nM	2.5	2.75
Template DNA			1	each tube
Q5 DNA Polymerase	2 U/µL	1 unit	0.5	0.55
Nuclease-free water		to 50 µL	32.5	35.8
Total			50	53.9 mix only

Put 49 µL of mix in each tube, then add 1 µL Template DNA.

attB-GFP PCR · 27 min 30 s plus ramps

Step	Temperature	Time	Cycles
Initial denaturation	98 °C	30 s	1
Denature	98 °C	10 s	×30^[3]
Anneal	63 °C	20 s
Extend	72 °C	20 s
Final extension	72 °C	2 min	1
Hold	4 °C	∞	1

attB-GFP PCR

Expected result

One band at 775 bp.

Troubleshooting

No band: Drop the annealing temperature by 3 °C and check the GFP template is there.^[3]
Several bands: Raise the annealing temperature, or gel-purify the band of the right size.^[3]

Notes

Each primer carries a whole attB tail: 4 G residues, the 25 bp att site and the frame bases the fusion needs, 29 bases forward and 29 reverse. A tail short of that is a published cause of few or no colonies.^[1]
The annealing temperature above is read from the annealing regions alone; a tail pairs with nothing on the template in the first cycles.
Over 70 bp of primer a two-step adapter PCR installs the same whole tail in two rounds; it is not planned here.^[1]

2Purify every amplicon

Run each reaction over a Monarch Spin PCR & DNA Cleanup column and elute in the smallest volume the kit allows.

Expected result

Clean DNA, free of polymerase, primers and dNTPs.

Troubleshooting

Low recovery: Elute in a larger volume and leave the buffer on the column longer.^[4]
An entry clone later runs as a 2.2 kb supercoiled plasmid: The BP reaction cloned attB primer-dimers instead; gel-purify this product before running BP again.^[1]

Notes

The BP reaction takes purified attB DNA: gel-purifying the product is the published fix for few or no colonies, and it takes the attB primers and their dimers away.^[1]

Make the entry clone

3Set up the BP reaction

Caution: Do not go over 250 ng of donor vector or 500 ng of DNA altogether: excess DNA inhibits the reaction.^[1]

Thaw the enzyme mix on ice and vortex it briefly twice.
Pipette the attB DNA, the donor vector and the TE buffer into a tube at room temperature.
Add 2 µL of Gateway BP Clonase II enzyme mix, mix well and spin down.

BP reaction

Reactions mix includes 10% extra

Component	Final	1 rxn (µL)	Mix for 1 (µL)
attB-GFP^[5]	0.05 pmol (23.87 ng)	1	each tube
pDONR-demo^[5]	0.05 pmol (20.36 ng)	1	each tube
TE buffer, pH 8.0	to 8 µL	6	6.6
Gateway BP Clonase II enzyme mix^[6]	to 10 µL	2	2.2
Total		10	8.8 mix only

Put 8 µL of mix in each tube, then add 1 µL attB-GFP, 1 µL pDONR-demo.

Expected result

A 10 µL reaction holding both DNAs.

Troubleshooting

The DNA does not fit the reaction volume: Concentrate either DNA, or scale the whole reaction up keeping the enzyme mix at its stated fraction of the volume.

Notes

The volumes above take each DNA at the concentration the table assumes; pipette what your prep needs for the picomoles and make the difference up with TE buffer, pH 8.0.
What is fixed is the picomoles and not the weight: 50 fmol of each, the attB DNA down to 20 fmol, weighed here from each record's own length.^[1]
A linear attB product and a supercoiled donor vector are the most efficient substrates for BP.^[6]

4Run the BP reaction

Incubate at 25 °C for 1 hour.

BP incubation

The entry clone the reaction makes: attL1 and attL2, the sites it writes where the two molecules crossed over.

Explore the mapClose the map

Open it in a new tab

Expected result

Nothing visible: the reaction is a recombination, not a digest.
The entry clone carries attL1 at 136, spelling CCAACTTTGTACAAAAAAGCAGGCT: its first bases from pDONR-demo and the rest from attB-GFP.
The entry clone carries attL2 at 878, spelling CCAACTTTGTACAAGAAAGCTGGGT: its first bases from pDONR-demo and the rest from attB-GFP.

Troubleshooting

Few or no colonies later, though the transformation control worked: Use an attB substrate with a donor vector (attP): the BP reaction takes those and no others. Do not freeze and thaw the enzyme mix more than ten times.^[1]

Notes

An attB substrate of 5,000 bp or more runs up to 18 hours instead; efficiency falls as the DNA gets longer.^[1]
Each att site is named by matching its 25 bp recombination region to that site's published sequence.^[7]
Junction positions are 1-based, on the entry clone.

5Stop the BP reaction with proteinase K

Add 1 µL of proteinase K at 2 µg/µL.
Incubate at 37 °C for 10 minutes.

Proteinase K, BP

Expected result

A reaction that can go straight into competent cells.

Notes

An untreated reaction is a published cause of few or no colonies, so this step is not optional.^[1]

6Transform and plate the BP reaction

Caution: Competent cells die if they warm up; keep them on ice until the shock.

Thaw 50 µL of TOP10 chemically competent E. coli on ice.
Add 1 µL of the BP reaction and flick the tube four or five times.
Hold on ice for 30 minutes.
Heat shock at 42 °C for 30 seconds.
Return to ice for 2 minutes.
Add 250 µL of outgrowth medium and shake at 37 °C for 60 minutes at 250 rpm.
Spread 100 µL of a 1:10 dilution on a warmed plate and grow overnight at 37 °C.

On iceHeat shockBack on iceOutgrowth

Expected result

More than 1,500 colonies where the whole reaction is transformed and plated, with cells at 100,000,000 cfu/µg or better.

Troubleshooting

No colonies: Check the antibiotic and the cells' efficiency, and plate the rest of the outgrowth.^[8]
A lawn: Plate a smaller volume or a greater dilution next time.
Two sizes of colony on the plate: The donor vector's ccdB gene has mutated or been deleted; the negative control then gives a similar count.^[1]

Notes

Colour does not report this insertion; screen every colony by PCR.
The clone is not expected to make GFP: no ribosome binding site is annotated ahead of it.
Unreacted donor vector and the by-product both keep the ccdB gene, which kills TOP10 chemically competent E. coli, so they do not grow. A strain carrying F' would supply ccdA and cancel that.
No manual states what fraction of the colonies is correct; the one count published found 195 of 197 correct after BP.^[9]

7Pick and miniprep the entry clone

Pick single colonies into overnight cultures on the plate's own antibiotic.
Miniprep each culture and measure what it yielded.
Take 50-150 ng of one prep into the LR reaction below.

Expected result

Supercoiled pDONR-demo-attB-GFP, concentrated enough to weigh 150 ng into the volume the LR table leaves for it.

Troubleshooting

The prep is too dilute for the reaction: Concentrate it, or pipette more of it and less TE buffer.
The prep runs as a 2.2 kb supercoiled plasmid: That size is a BP reaction that cloned attB primer-dimers. Gel-purify the attB DNA and amplify it with a hot-start polymerase before running BP again.^[1]

Notes

The LR reaction takes purified entry clone and not the stopped BP reaction: 50-150 ng is a weight of miniprep DNA, and no plan can weigh a yield nobody has measured yet.
Supercoiled miniprep DNA is the most efficient substrate for LR.^[10]
The one-tube protocol chains the two reactions without this step and gives at least 10-20% of the expression clones the staged route gives, each of which it says to sequence. It runs on its own timings and is not the protocol below.^[1]

Recombine

8Set up the LR reaction

Caution: Do not go over 150 ng of entry clone.^[10]

Thaw the enzyme mix on ice and vortex it briefly twice.
Pipette the two plasmids and the TE buffer into a tube at room temperature.
Add 2 µL of Gateway LR Clonase II enzyme mix, mix well and spin down.

LR reaction

Reactions mix includes 10% extra

Component	Final	1 rxn (µL)	Mix for 1 (µL)
pDONR-demo-attB-GFP^[5]	0.235 pmol (150 ng)	1	each tube
pDEST-demo^[5]	0.515 pmol (150 ng)	1	each tube
TE buffer, pH 8.0	to 8 µL	6	6.6
Gateway LR Clonase II enzyme mix^[10]	to 10 µL	2	2.2
Total		10	8.8 mix only

Put 8 µL of mix in each tube, then add 1 µL pDONR-demo-attB-GFP, 1 µL pDEST-demo.

Expected result

A 10 µL reaction holding both plasmids.

Troubleshooting

The DNA does not fit the reaction volume: Concentrate either DNA, or scale the whole reaction up keeping the enzyme mix at its stated fraction of the volume.

Notes

The volumes above take each DNA at the concentration the table assumes; pipette what your prep needs for the nanograms and make the difference up with TE buffer, pH 8.0.
Above 150 ng of entry clone the colonies carry several molecules, and below 50 ng there are fewer of them.^[10]
Supercoiled plasmids are the most efficient substrates for LR.^[10]

9Run the LR reaction

Incubate at 25 °C for 1 hour.

LR incubation

The expression clone the reaction makes: attB1 and attB2, the sites it writes where the two molecules crossed over.

Explore the mapClose the map

Open it in a new tab

Expected result

Nothing visible: the reaction is a recombination, not a digest.
The expression clone carries attB1 at 89, spelling ACAAGTTTGTACAAAAAAGCAGGCT: its first bases from pDEST-demo and the rest from pDONR-demo-attB-GFP.
The expression clone carries attB2 at 831, spelling ACCACTTTGTACAAGAAAGCTGGGT: its first bases from pDEST-demo and the rest from pDONR-demo-attB-GFP.

Troubleshooting

Few or no colonies later, though the transformation control worked: Use an entry clone (attL) with a destination vector (attR): the LR reaction takes those and no others. Do not freeze and thaw the enzyme mix more than ten times.^[1]

Notes

A plasmid of 10,000 bp or more runs up to 18 hours instead; efficiency falls as the DNA gets longer.^[1]
Each att site is named by matching its 25 bp recombination region to that site's published sequence.^[7]
Junction positions are 1-based, on the expression clone.

10Stop the LR reaction with proteinase K

Add 1 µL of proteinase K at 2 µg/µL.
Incubate at 37 °C for 10 minutes.

Proteinase K, LR

Expected result

A reaction that can go straight into competent cells.

Notes

An untreated reaction is a published cause of few or no colonies, so this step is not optional.^[1]

Transform and screen

11Transform and plate the LR reaction

Caution: Competent cells die if they warm up; keep them on ice until the shock.

Thaw 50 µL of TOP10 chemically competent E. coli on ice.
Add 1 µL of the LR reaction and flick the tube four or five times.
Hold on ice for 30 minutes.
Heat shock at 42 °C for 30 seconds.
Return to ice for 2 minutes.
Add 250 µL of outgrowth medium and shake at 37 °C for 60 minutes at 250 rpm.
Spread 100 µL of a 1:10 dilution on a warmed plate and grow overnight at 37 °C.

On iceHeat shockBack on iceOutgrowth

Expected result

More than 5,000 colonies where the whole reaction is transformed and plated, with cells at 100,000,000 cfu/µg or better.

Troubleshooting

No colonies: Check the antibiotic and the cells' efficiency, and plate the rest of the outgrowth.^[8]
A lawn: Plate a smaller volume or a greater dilution next time.
Small colonies beside large ones: Usually unreacted pDONR-demo-attB-GFP co-transforming; restreak them on the entry clone's own antibiotic to tell.^[1]

Notes

Colour does not report this insertion; screen every colony by PCR.
Unreacted destination vector and the by-product both keep the ccdB gene, which kills TOP10 chemically competent E. coli, so they do not grow. A strain carrying F' would supply ccdA and cancel that.
No manual states what fraction of the colonies is correct; the one count published found 96 of 102 correct after LR.^[9]
The expression clone lost the chloramphenicol cassette with the by-product, so restreaking a colony on 30 µg/mL chloramphenicol confirms it: a true expression clone does not grow there, and one carrying a mutated ccdB gene does.

12Screen colonies by PCR

Touch a well-separated colony with a sterile toothpick and stir it into the tube until the liquid clouds.
Streak the same toothpick onto a numbered plate, so the clone survives the PCR.
Run the program below and load 5 µL on a 2% gel.

Colony PCR

Reactions mix includes 10% extra

Component	Stock	Final	1 rxn (µL)	Mix for 1 (µL)
OneTaq Quick-Load 2X Master Mix with Standard Buffer (M0486)	2X	1X	12.5	13.8
Forward primer	10 µM	200 nM	0.5	0.55
Reverse primer	10 µM	200 nM	0.5	0.55
Nuclease-free water		to 25 µL	11.5	12.7
Total			25	27.5

Put 25 µL of mix in each tube.

Colony PCR · 1 h 10 min plus ramps

Step	Temperature	Time	Cycles
Lysis	94 °C	5 min	1
Denature	94 °C	30 s	×30^[11]
Anneal	57 °C	30 s
Extend	68 °C	1 min
Final extension	68 °C	5 min	1
Hold	10 °C	∞	1

Colony PCR

Expected result

Each of the 2 junctions is read: the flanking pair crosses them all.
Correct clone: 871 bp.
Empty vector: 429 bp.

Colony PCR

L NEB 100 bp DNA Ladder (N3231)
1 Correct clone: 871 bp
2 Empty vector: 429 bp

Troubleshooting

No band in any lane: The colony was too much material: touch a smaller one, or dilute it.^[12]
The plate carries large colonies and small ones: The small ones are usually unreacted pDONR-demo-attB-GFP co-transforming. It carries neither of these primers, so it adds no band here; restreak on the entry clone's own antibiotic to tell.^[1]

Notes

The long first step at 94 °C lyses the cells; there is no purified template.
Both primers sit in the destination vector's backbone, so one product crosses both attB junctions and an unrecombined vector gives a band of its own.
An unrecombined destination vector still carries ccdB, which kills TOP10 chemically competent E. coli, so its lane is what a strain supplying ccdA or a damaged ccdB gene would put on the plate.
A restriction digest beside this screen is recommended the first time it is run: mispriming and contaminating template both give artefacts.^[13]

13Confirm the clone by sequencing

Miniprep two or three colonies that read as correct.
Send each miniprep with both sequencing primers.
Send at least 500 ng of plasmid with 5-50 pmol of each primer.
Check each read against product.dna; keep a clone only when every junction and insert reads true.

Expected result

Sequencing forward anneals 103 bp from its own junction and has to read 854 bp to cover the far one.
Sequencing reverse anneals 117 bp from its own junction and has to read 868 bp to cover the far one.
The junctions read as ACAAGTTTGTACAAAAAAGCAGGCT and ACCACTTTGTACAAGAAAGCTGGGT, and the parts match pDONR-demo-attB-GFP.

Troubleshooting

The read starts too close to the junction: Move the primer further out; the first bases after a primer are unreadable.^[14]

Notes

Only a read across the junctions confirms the assembly, whatever the screen said.
A provider whose read is shorter than the lengths above needs a further primer inside the inserts.
No kit primer reads these junctions: GW1 and GW2 suit pCR8/GW/TOPO alone, and an M13 primer crosses at least 130 bp of vector first. Both primers above are designed against this record.^[15]

Sources

Thermo Fisher Scientific #MAN0000470 Gateway Technology with Clonase II user guide · part 25-0749, revision 2 April 2012 · 2026-09-18 · docs/research/gateway-cloning.md cited at pp. 43-44 · pp. 47-48 · p. 21 · pp. 21-22 · p. 40 · p. 23 · p. 41 · pp. 45-46 · p. 32
New England Biolabs #N3231 100 bp DNA Ladder product page · capture 2025-10-31 · Wayback Machine · docs/research/primer-design-and-pcr.md cited at band sizes
New England Biolabs #M0491 Q5 High-Fidelity DNA Polymerase protocol page · capture 2024-08-04 · Wayback Machine · 2026-09-12 cited at thermocycling conditions · annealing temperature
New England Biolabs #T1130 Monarch Spin PCR & DNA Cleanup Kit instruction manual · version 1.0 06.24 · 2026-09-18 · docs/research/restriction-ligation.md cited at troubleshooting, low DNA yield
New England Biolabs NEBioCalculator · script main-6f3020c533.js, capture 2026-08-28 · Wayback Machine · docs/research/primer-design-and-pcr.md cited at dsDNA molecular weight
Thermo Fisher Scientific Gateway BP Clonase II enzyme mix product sheet · 11789.II.pps, revision 31 October 2010 · 2026-09-18 · docs/research/gateway-cloning.md cited at p. 3 · p. 2
Brasch, M., Cheo, D., Hartley, J. and Temple, G., US 7,670,823 B1 · docs/research/gateway-cloning.md https://patents.google.com/patent/US7670823B1/en cited at FIG. 9
New England Biolabs, Troubleshooting Guide for Cloning · 2026-09-18 · docs/research/restriction-ligation.md https://www.neb.com/en-us/tools-and-resources/troubleshooting-guides/troubleshooting-guide-for-cloning cited at few or no transformants
Hartley, J.L., Temple, G.F. and Brasch, M.A. (2000) DNA cloning using in vitro site-specific recombination. Genome Res. 10, 1788-1795 · docs/research/gateway-cloning.md https://doi.org/10.1101/gr.143000 cited at Results
Thermo Fisher Scientific #MAN0001032 Gateway LR Clonase II enzyme mix product sheet · revision A.0 · 2026-09-18 · docs/research/gateway-cloning.md cited at p. 2 · p. 3
New England Biolabs #M0480 OneTaq DNA Polymerase protocol · protocols.io version 2, 2022-02-21 · 2026-09-12 https://dx.doi.org/10.17504/protocols.io.bd24i8gw cited at thermocycling conditions
New England Biolabs application note, Robust Colony PCR from Multiple E. coli Strains using OneTaq Quick-Load Master Mixes · Y. Xu, 11/13 · 2026-09-12 · docs/research/primer-design-and-pcr.md cited at template
Thermo Fisher Scientific #MAN0000291 Gateway pDONR Vectors user guide · part 25-0531, revised 29 March 2012 · 2026-09-18 · docs/research/gateway-cloning.md cited at p. 10
Azenta/Genewiz, Sanger sequencing FAQ and technical notes · 2026-09-12 · docs/research/primer-design-and-pcr.md cited at sequencing primer design
Thermo Fisher Scientific #MAN0000437 pCR8/GW/TOPO TA Cloning Kit user guide · part 25-0706, revised 23 March 2012 · 2026-09-18 · docs/research/gateway-cloning.md cited at p. 13