Final cargo ligation

Protocol 7 of 7. Comes after Library assembly in rounds. The run ends here.

Release the finished cargo from DMX-iGGA and move it into the vector the application asks for.

Have in hand

  • library prep, round 3 the pooled library after round 3, as a plasmid prep
  • working vector the backbone the library ends in

Leaves you with

  • the library in its working vector 3 part lists joined, pooled and ready for the screen
0 of 5 steps done

Materials

NameSupplierCatalogueStoragePer runNoteSource
pLVX-TetOne-dom vector-20 °Cthe library's final home; PaqCI releases its ccdB cassette to admit the cargo
PaqCINew England BiolabsR0745-20 °C2.5 µL per digestadmits the finished cargo to the working vector
BsaI-HFv2New England BiolabsR3733-20 °C2.5 µL per digestreleases a part from its own block
PmeINew England BiolabsR0560-20 °C2.5 µL per digestcuts the donor backbone, so it cannot ligate back
CutSmart Buffer-20 °Cboth digests run in it
T7 DNA LigaseNEB#M0318L-20 °C3,000,000 U/mL. Refuses blunt ends, which is what removes escapees.[1]
StickTogether DNA Ligase BufferNEB#B0535S-20 °CSupplied 2x. 1x is 7.5% PEG 6000, well under the 20% that would force blunt ligation.[1]
SPRI paramagnetic beads2 volumes after a digest, 1 after a ligationthe two ratios differ; both elute in water
Endura ElectroCompetent CellsLucigen60242-2-80 °C4 aliquots, one a pulse, 25 µL eachpulsed at 1800 V, 600 Ω and 10 µF in a 1 mm cuvette[2]
Selective plates for the final transferLB with 100 µg/mL carbenicillin, the working vector's own marker (AmpR)
Plasmid prep kitone prep per round
Electroporation cuvettes4, one a pulse

Equipment: Incubator or heat block at 37 °C, Magnetic rack for the bead clean-ups, Electroporator and cuvettes, Shaking incubator at 30 °C, Spectrophotometer (NanoDrop) or fluorometer (Qubit), Short-read sequencer, for the final representation read of the finished library

  • T7 DNA Ligase: never PEG Never add PEG to a T7 ligase reaction. Blunt-end ligation is forced above 20% (w/v) PEG 6000, and StickTogether buffer already carries 7.5%; the refusal that removes escapees holds only while nothing adds more.[1]
  • T7 DNA Ligase: never heat inactivation Do not heat-inactivate T7 DNA ligase in PEG: transformation will be inhibited. Go from the ligation straight to the clean-up.[1]

Caution: Keep the cells and the cuvette on ice; a warm cuvette arcs.

Choose the working vector

Expected result

  • 10284 bp opens on AGGA and TTCC, giving up its 385 bp ccdB cassette.
  • Two bands and no more: PaqCI reads this vector nowhere else.

Troubleshooting

The stock will not open
The cassette is not where the record says, or the enzyme has lost activity. Sequence the stock before assembling into it.

Notes

  • PaqCI cuts nothing in the final-assembly pot but the cassette it opens.
  • ccdB is what makes the assembly self-selecting: a vector that took no cargo keeps the cassette and kills its host.

Move the library across

Digest with BsaI and PmeI
mix includes 10% extra
ComponentStockFinal1 rxn (µL)Mix for 1 (µL)
AP-1 DESynR round 3[3]0.252 pmol (1000 ng)1each tube
BsaI-HFv2 (R3733)[4]R3733L, 20 U/µL50 units2.52.75
PmeI (R0560)[4]R0560L, 10 U/µL25 units2.52.75
CutSmart Buffer and nuclease-free waterto 50 µL4448.4
Total5053.9
mix only

Put 49 µL of mix in each tube, then add 1 µL AP-1 DESynR round 3.

Digest with BsaI and PmeI · 1 h
StepTemperatureTimeCycles
BsaI and PmeI37 °C1 h1
BsaI heat inactivation · 20 min
StepTemperatureTimeCycles
Heat inactivation80 °C20 min1
PmeI heat inactivation · 20 min
StepTemperatureTimeCycles
Heat inactivation65 °C20 min1

Expected result

  • The whole 1076 bp cargo free, on AGGA and TTCC, out of 6435 bp of library.
  • PmeI cuts the backbone it came out of, so that backbone cannot close again.

Troubleshooting

The library backbone survives the assembly
The blunt enzyme missed, or the heat kill was short. Both show up as colonies carrying the round's own vector rather than the working one.

Notes

  • One tube, two stages. Killing the releasing enzymes before the working vector goes in is what keeps them off its backbone.

  • T7 DNA Ligase: never PEG Never add PEG to a T7 ligase reaction. Blunt-end ligation is forced above 20% (w/v) PEG 6000, and StickTogether buffer already carries 7.5%; the refusal that removes escapees holds only while nothing adds more.[1]
One-pot assembly
mix includes 10% extra
ComponentFinal1 rxn (µL)Mix for 1 (µL)
AP-1 DESynR round 3 cargo, in the release[3]0.252 pmol (167.21 ng)50each tube
pLVX-TetOne-dom, opened[3]0.0123 pmol (75 ng)1each tube
PaqCI (R0745)2.52.75
T7 DNA Ligase in StickTogether DNA Ligase Buffer, and nuclease-free waterto 200 µL147161
Total200164
mix only

Put 149 µL of mix in each tube, then add 50 µL AP-1 DESynR round 3 cargo, in the release, 1 µL pLVX-TetOne-dom, opened.

Golden Gate assembly · 1 h 5 min plus ramps
StepTemperatureTimeCycles
Assembly37 °C1 h1[5]
End soak60 °C5 min1[5]
350360370380390PmeIN entry junctionN_JUNBsaI (370)AP-1 DESynR round 3347 .. 398 (52 bp)350 360 370 380 390TACAGTTTAAACTATGGGGTCTCAAGGAATGACCGCCAAGATGGAAACCACCATGTCAAATTTGATACCCCAGAGTTCCTTACTGGCGGTTCTACCTTTGGTGG398PmeIN entry junctionMet Thr Ala Lys Met Glu Thr ThrN_JUNBsaI
The end the library is freed on, which the working vector takes: BsaI leaves AGGA here.[6]
Explore the mapClose the mapOpen it in a new tab

Expected result

  • One circular final vector a member, about 10975 bp, joined on AGGA and TTCC.
  • The ccdB cassette is displaced, so a vector that took no cargo kills its host.

Troubleshooting

Colonies that are still ccdB-positive
The working vector was not opened to completion. Check the pick step's gel before repeating.

Notes

  • 6435 bp of library goes in and the cargo alone comes out: the backbone the rounds ran in is shredded and stays behind.
  • The cycling is NEB's longer single-insert program, which it gives for library preparation rather than for cloning one gene.
  • 75 ng of vector is what this run measured, not a published figure. The cargo is not measured out: the release tube goes in whole.
  • The release delivers the cargo at 20.5:1 over the vector, which is what the digest frees and not a ratio anyone sets.

Caution: Keep the cells and the cuvette on ice; a warm cuvette arcs.

Recovery and outgrowth at 30 °C · 13 h
StepTemperatureTimeCycles
Recovery, shaking30 °C1 h1[7]
Outgrowth30 °C12 h1[7]

Expected result

  • At least 195,386 net colonies: the floor for the 0.99 chance this design asked for that none of its 13,824 distinct members is missing, equally represented.
  • At that count the chance a named member is missing is 7.27 × 10⁻⁷.
  • Near-empty plates from the no-cargo control beside it; what grows there is working vector that kept its ccdB cassette.

— net colonies.

Troubleshooting

Fewer net colonies than the count above
The library has lost members in the transfer. Nothing downstream puts them back; repeat the assembly from more of the released cargo.

Notes

  • This is a bottleneck like a round's, and the library can only lose members here. Electroporate all of the assembly rather than a measured part of it.
  • The settings are the cells' own and are keyed by their catalogue number, not set by this method.
  • ccdB does the selecting here, so the plates carry pLVX-TetOne-dom's own marker.

Read the library back

Expected result

  • The same combinations, at a similar evenness. A combination seen before the move and not after it was lost in the transfer into pLVX-TetOne-dom.
  • At least 99.5% of what survived the move seen; a 90th/10th percentile skew ratio below 10, judged at 100 or more reads a member, which is 1,382,400 reads over 13,824 combinations.[8]

Troubleshooting

Markedly fewer combinations than before the move
The transfer was the bottleneck, not the rounds. Compare the colony count with the step above before rebuilding anything.

Notes

  • Linkage is read once, in the library backbone; a barcode still names the same part after the move, because the move carries the whole cargo in one piece.
  • The forward anchor is the same retained internal stuffer, which travels with the cargo; the reverse anchor moved with the vector, so this pair is designed against the final record rather than reused from the read before the move.

Sources

  1. New England Biolabs #M0318 T7 DNA Ligase product page · r.jina.ai · 2026-10-06 https://www.neb.com/en/products/m0318-t7-dna-ligase cited at reaction conditions · note 4
  2. Endura Competent Cells manual, Lucigen / Biosearch Technologies · MA133 26Feb2018 · plain curl · 2026-10-06 cited at p. 4-5
  3. New England Biolabs NEBioCalculator · script main-6f3020c533.js, capture 2026-08-28 · Wayback Machine · docs/research/primer-design-and-pcr.md cited at dsDNA molecular weight
  4. New England Biolabs product specification sheets · #R3733S/L, #R3539S/L, #R0629S/L, #R0560S/L · plain curl · 2026-10-06 · docs/research/bench-numbers.md cited at #R3733L, concentration · #R0560L, concentration
  5. New England Biolabs, Protocol for NEBridge Ligase Master Mix (NEB #M1100) · capture 2023-03-31 · Wayback Machine · docs/research/golden-gate-assembly.md https://web.archive.org/web/20230331002719id_/https://www.neb.com/protocols/2021/09/14/protocol-for-nebridge-ligase-master-mix-neb-m1100 cited at cycling
  6. liulab-mbio, Figure sources for four designs · docs/research/figure-sources.md cited at section 2, Cargo GGA ligation
  7. Takacsi-Nagy, O. et al. (2026) Synthetic transcription factors designed by domain recombination enhance CAR T cell antitumor function. Cell 189, 1-20 · STAR Methods, METHOD DETAILS pp. e4-e5 · docs/research/protein-library-assembly.md https://doi.org/10.1016/j.cell.2026.07.054 cited at p. e5, recovery and outgrowth
  8. Joung, J. et al. (2017) Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening. Nat. Protoc. 12, 828-863 · docs/research/vector-qc-panel.md https://doi.org/10.1038/nprot.2017.016 cited at library representation