Not verified

pUC19-GFP: 1 result

WhereVerdictDetail
ATGA junctionpassevery base read, and none disagrees
GFP insertfailsubstitution at 696
TGGC junctionpassevery base read, and none disagrees
AmpR, outside every regionno verdictsubstitution at 2687, read by consensus.fasta
consensus.fastapassreads 1 .. 3347 on the forward strand; a consensus alone cannot show a mixed sample, because the commonest plasmid becomes the consensus

Map

50010001500200025003000lacZαGFPoriAmpRM13 fwdATGA junctionMCSTGGC junctionM13 revlac operatorlac promoterAmpR promoter696 A>G2687 C>TpUC19 backbone forward (1117 .. 1140)pUC19 backbone reverse (378 .. 395)GFP forward (400 .. 424)GFP reverse (1087 .. 1112)Colony PCR forward (345 .. 365)Colony PCR reverse (1155 .. 1182)Junction reverse (481 .. 504)Sequencing forward (257 .. 272)Sequencing reverse (1232 .. 1251)consensus.fasta (1 .. 3347)pUC19-GFP3347 bp

Each disagreement

696 A>G substitution in GFP insert (fail), read by consensus.fasta.
670680690700710720GFP696 A>Gconsensus.fasta (1 .. 3347)pUC19-GFP666 .. 726 (61 bp)670 680 690 700 710 720GGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGCCAATACATGTCCTTTCTTGATATAAAAAGTTTCTACTGCCCTTGATGTTCTGTGCACGAC726Gly Tyr Val Gln Glu Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg AlaGFP696 A>Gconsensus.fasta (1 .. 3347)
2687 C>T substitution in AmpR, outside every region, read by consensus.fasta.
266026702680269027002710AmpR2687 C>Tconsensus.fasta (1 .. 3347)pUC19-GFP2657 .. 2717 (61 bp)2660 2670 2680 2690 2700 2710TCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTAGGGTTGCTAGTTCCGCTCAATGTACTAGGGGGTACAACACGTTTTTTCGCCAATCGAGGA2717Glu Trp Arg Asp Leu Arg Thr Val His Asp Gly Met Asn His Leu Phe Ala Thr Leu Glu LysAmpR2687 C>Tconsensus.fasta (1 .. 3347)