{ "title": "Golden Gate assembly: GFP into pUC19", "key": "ce16dbdff3e81a3e", "summary": "Open pUC19 by PCR across 395-451, amplify GFP with BbsI tails, join the 2 fragments in one Golden Gate reaction, and confirm the clone by colony PCR and sequencing.", "overview": { "Vector": "pUC19, 2686 bp", "Insert": "GFP, 717 bp", "Enzyme": "BbsI-HF (R3539) at 37 °C", "Fragments": "2 in one reaction", "Overhangs": "ATGA and TGGC", "Fidelity": "100%, measured", "Product": "pUC19-GFP, 3347 bp", "Selection": "ampicillin or carbenicillin" }, "highlights": [ "One reaction joins 2 fragments: pUC19 backbone (2630 bp) and GFP (717 bp).", "GFP reads on the opposite strand from lac promoter, 61 bp away, so that promoter does not transcribe it.", "There is no ribosome binding site annotated ahead of GFP, so the clone is not expected to make its protein.", "The insertion interrupts lacZα, so correct clones are white and empty vector is blue on X-gal and IPTG." ], "background": [], "checks": [ { "name": "sites", "status": "pass", "detail": "BbsI no longer cuts the product" }, { "name": "pUC19 backbone", "status": "pass", "detail": "2630 bases, whole and once" }, { "name": "GFP", "status": "pass", "detail": "717 bases, whole and once" }, { "name": "junctions", "status": "pass", "detail": "ATGA at 396, TGGC at 1113" }, { "name": "primers", "status": "warn", "detail": "9 designed, 2 with a warning, 0 failing: GC on 1, Tm on 1; not judged: full-primer Tm, 3' end stability" } ], "choice": "", "consumes": [], "produces": [], "materials": [ { "name": "pUC19 plasmid", "supplier": "", "catalog": "", "storage": "-20 °C", "amount": "", "note": "PCR template", "contains": [], "rules": [], "cautions": [], "citation": null }, { "name": "GFP template", "supplier": "", "catalog": "", "storage": "-20 °C", "amount": "", "note": "PCR template", "contains": [], "rules": [], "cautions": [], "citation": null }, { "name": "Q5 DNA Polymerase and its reaction buffer", "supplier": "New England Biolabs", "catalog": "", "storage": "-20 °C", "amount": "", "note": "", "contains": [], "rules": [], "cautions": [], "citation": null }, { "name": "dNTP mix", "supplier": "", "catalog": "", "storage": "-20 °C", "amount": "", "note": "10 mM of each base", "contains": [], "rules": [], "cautions": [], "citation": null }, { "name": "DpnI", "supplier": "New England Biolabs", "catalog": "", "storage": "-20 °C", "amount": "20 units per PCR", "note": "cuts the methylated plasmid template only", "contains": [], "rules": [], "cautions": [], "citation": null }, { "name": "Monarch Spin PCR & DNA Cleanup Kit", "supplier": "New England Biolabs", "catalog": "T1130", "storage": "", "amount": "", "note": "", "contains": [], "rules": [], "cautions": [], "citation": null }, { "name": "NEBridge Ligase Master Mix", "supplier": "New England Biolabs", "catalog": "M1100", "storage": "-20 °C", "amount": "5 µL per reaction", "note": "", "contains": [], "rules": [], "cautions": [], "citation": null }, { "name": "BbsI-HF", "supplier": "New England Biolabs", "catalog": "R3539", "storage": "-20 °C", "amount": "1 µL per reaction", "note": "", "contains": [], "rules": [], "cautions": [], "citation": null }, { "name": "NEB 5-alpha Competent E. coli", "supplier": "New England Biolabs", "catalog": "C2987", "storage": "-80 °C", "amount": "50 µL per transformation", "note": "", "contains": [], "rules": [], "cautions": [], "citation": null }, { "name": "SOC or NEB 10-beta/Stable Outgrowth Medium", "supplier": "", "catalog": "", "storage": "", "amount": "950 µL per transformation", "note": "", "contains": [], "rules": [], "cautions": [], "citation": null }, { "name": "LB agar plates with ampicillin or carbenicillin, 80 µg/mL X-gal and 200 µM IPTG", "supplier": "", "catalog": "", "storage": "", "amount": "one plate per transformation", "note": "", "contains": [], "rules": [], "cautions": [], "citation": { "source": "potapov-2018", "locator": "methods" } }, { "name": "Plasmid miniprep kit", "supplier": "", "catalog": "", "storage": "", "amount": "", "note": "for the clones that go to sequencing", "contains": [], "rules": [], "cautions": [], "citation": null }, { "name": "OneTaq Quick-Load 2X Master Mix with Standard Buffer", "supplier": "New England Biolabs", "catalog": "M0486", "storage": "-20 °C", "amount": "12.5 µL per reaction", "note": "", "contains": [], "rules": [], "cautions": [], "citation": null }, { "name": "Agarose and 1X TAE or TBE", "supplier": "", "catalog": "", "storage": "", "amount": "", "note": "", "contains": [], "rules": [], "cautions": [], "citation": null }, { "name": "NEB 1 kb Plus DNA Ladder", "supplier": "New England Biolabs", "catalog": "N3200", "storage": "", "amount": "", "note": "", "contains": [], "rules": [], "cautions": [], "citation": { "source": "N3200", "locator": "band sizes" } }, { "name": "NEB 100 bp DNA Ladder", "supplier": "New England Biolabs", "catalog": "N3231", "storage": "", "amount": "", "note": "", "contains": [], "rules": [], "cautions": [], "citation": { "source": "N3231", "locator": "band sizes" } } ], "oligos": [ { "name": "pUC19 backbone forward", "sequence": "AAACACGAAGACAATGGCGTAATCATGGTCATAGCTGTTTCC", "purpose": "Amplify pUC19 backbone", "tm_c": 63.0, "stock": "10 µM", "note": "", "status": "pass", "checks": [] }, { "name": "pUC19 backbone reverse", "sequence": "AAACACGAAGACAATCATACTGGCCGTCGTTTTACA", "purpose": "Amplify pUC19 backbone", "tm_c": 64.1, "stock": "10 µM", "note": "", "status": "warn", "checks": [ { "name": "Tm", "status": "warn", "detail": "64.1 °C (band 60-64)" } ] }, { "name": "GFP forward", "sequence": "AAACACGAAGACAAATGAGTAAAGGAGAAGAACTTTTCACTGG", "purpose": "Amplify GFP", "tm_c": 63.0, "stock": "10 µM", "note": "", "status": "pass", "checks": [] }, { "name": "GFP reverse", "sequence": "AAACACGAAGACAAGCCACTATTTGTATAGTTCATCCATGCCAT", "purpose": "Amplify GFP", "tm_c": 62.0, "stock": "10 µM", "note": "", "status": "warn", "checks": [ { "name": "GC", "status": "warn", "detail": "35% (band 40-60)" } ] }, { "name": "Colony PCR forward", "sequence": "TGGGTAACGCCAGGGTTTTCC", "purpose": "Screen colonies by PCR", "tm_c": 61.9, "stock": "10 µM", "note": "", "status": "pass", "checks": [] }, { "name": "Colony PCR reverse", "sequence": "CGTATGTTGTGTGGAATTGTGAGCGGAT", "purpose": "Screen colonies by PCR", "tm_c": 62.2, "stock": "10 µM", "note": "", "status": "pass", "checks": [] }, { "name": "Junction reverse", "sequence": "CATCACCTTCACCCTCTCCACTGA", "purpose": "Screen colonies by PCR", "tm_c": 62.0, "stock": "10 µM", "note": "", "status": "pass", "checks": [] }, { "name": "Sequencing forward", "sequence": "GCGCAACTGTTGGGAA", "purpose": "Confirm the clone by sequencing", "tm_c": 63.3, "stock": "10 µM", "note": "", "status": "pass", "checks": [] }, { "name": "Sequencing reverse", "sequence": "CGCAACGCAATTAATGTGAG", "purpose": "Confirm the clone by sequencing", "tm_c": 62.2, "stock": "10 µM", "note": "", "status": "pass", "checks": [] } ], "order_sheet": "primers.tsv", "files": [ "primers.tsv", "product.dna" ], "equipment": [ "Thermocycler with a heated lid", "Agarose gel rig and power supply", "Microcentrifuge", "Spectrophotometer (NanoDrop) or fluorometer (Qubit)", "Heat block or water bath at 42 °C", "Shaking incubator and a plate incubator at 37 °C" ], "vessels": [], "plates": [], "steps": [ { "title": "Amplify pUC19 backbone", "key": "pcr-puc19-backbone", "section": "Make the fragments", "instructions": [ "Thaw the buffer, dNTPs and primers on ice, then vortex and spin them down.", "Mix the master mix, dispense it into each tube, then add the pUC19 template.", "Run the program below: 64 °C annealing and 60 s extension for a 2662 bp product." ], "cautions": [ "Keep the polymerase on ice." ], "notes": [ "The cycle count is the fewest enough for an amplicon going into an assembly; fewer cycles means fewer PCR errors." ], "tables": [ { "components": [ { "name": "Q5 Reaction Buffer", "volume_ul": 10.0, "stock": "5X", "final": "1X", "master_mix": true, "citation": null, "calculator": null }, { "name": "dNTP mix", "volume_ul": 1.0, "stock": "10 mM each", "final": "200 µM each", "master_mix": true, "citation": null, "calculator": null }, { "name": "Forward primer", "volume_ul": 2.5, "stock": "10 µM", "final": "500 nM", "master_mix": true, "citation": null, "calculator": null }, { "name": "Reverse primer", "volume_ul": 2.5, "stock": "10 µM", "final": "500 nM", "master_mix": true, "citation": null, "calculator": null }, { "name": "Template DNA", "volume_ul": 1.0, "stock": "", "final": "", "master_mix": false, "citation": null, "calculator": null }, { "name": "Q5 DNA Polymerase", "volume_ul": 0.5, "stock": "2 U/µL", "final": "1 unit", "master_mix": true, "citation": null, "calculator": null }, { "name": "Nuclease-free water", "volume_ul": 32.5, "stock": "", "final": "to 50 µL", "master_mix": true, "citation": null, "calculator": null } ], "title": "pUC19 backbone PCR", "reactions": 1, "overage": 0.1 } ], "programs": [ { "stages": [ { "incubations": [ { "label": "Initial denaturation", "temperature_c": 98.0, "seconds": 30, "delta_c": null, "citation": null } ], "cycles": 1, "citation": null }, { "incubations": [ { "label": "Denature", "temperature_c": 98.0, "seconds": 10, "delta_c": null, "citation": null }, { "label": "Anneal", "temperature_c": 64.0, "seconds": 20, "delta_c": null, "citation": null }, { "label": "Extend", "temperature_c": 72.0, "seconds": 60, "delta_c": null, "citation": null } ], "cycles": 20, "citation": { "source": "E1601", "locator": "FAQ 11" } }, { "incubations": [ { "label": "Final extension", "temperature_c": 72.0, "seconds": 120, "delta_c": null, "citation": null } ], "cycles": 1, "citation": null }, { "incubations": [ { "label": "Hold", "temperature_c": 4.0, "seconds": null, "delta_c": null, "citation": null } ], "cycles": 1, "citation": null } ], "title": "pUC19 backbone PCR", "lid_temperature_c": null } ], "timers": [], "waits": [], "hands_on_seconds": null, "transfers": [], "figures": [ { "records": [ "puc19-backbone-amplicon.dna" ], "caption": "The pUC19 backbone amplicon's forward end: the BbsI site its tail carries, and the TGGC overhang the cut leaves. The reverse end leaves ATGA.", "span": [ 0, 48 ], "linear": true, "sequence_view": true, "enzymes": [ "BbsI" ], "highlight": [ "pUC19 backbone forward", "BbsI", "BbsI site", "TGGC overhang" ], "citation": null } ], "gels": [], "expected": [ "One band at 2662 bp." ], "calculator": null, "troubleshooting": [ { "problem": "No band", "solution": "Drop the annealing temperature by 3 °C and check the pUC19 template is there.", "citation": { "source": "M0491", "locator": "annealing temperature" } }, { "problem": "Several bands", "solution": "Raise the annealing temperature, or gel-purify the band of the right size.", "citation": { "source": "M0491", "locator": "annealing temperature" } } ], "holes": [] }, { "title": "Amplify GFP", "key": "pcr-gfp", "section": "Make the fragments", "instructions": [ "Thaw the buffer, dNTPs and primers on ice, then vortex and spin them down.", "Mix the master mix, dispense it into each tube, then add the GFP template.", "Run the program below: 63 °C annealing and 20 s extension for a 749 bp product." ], "cautions": [ "Keep the polymerase on ice." ], "notes": [ "The cycle count is the fewest enough for an amplicon going into an assembly; fewer cycles means fewer PCR errors." ], "tables": [ { "components": [ { "name": "Q5 Reaction Buffer", "volume_ul": 10.0, "stock": "5X", "final": "1X", "master_mix": true, "citation": null, "calculator": null }, { "name": "dNTP mix", "volume_ul": 1.0, "stock": "10 mM each", "final": "200 µM each", "master_mix": true, "citation": null, "calculator": null }, { "name": "Forward primer", "volume_ul": 2.5, "stock": "10 µM", "final": "500 nM", "master_mix": true, "citation": null, "calculator": null }, { "name": "Reverse primer", "volume_ul": 2.5, "stock": "10 µM", "final": "500 nM", "master_mix": true, "citation": null, "calculator": null }, { "name": "Template DNA", "volume_ul": 1.0, "stock": "", "final": "", "master_mix": false, "citation": null, "calculator": null }, { "name": "Q5 DNA Polymerase", "volume_ul": 0.5, "stock": "2 U/µL", "final": "1 unit", "master_mix": true, "citation": null, "calculator": null }, { "name": "Nuclease-free water", "volume_ul": 32.5, "stock": "", "final": "to 50 µL", "master_mix": true, "citation": null, "calculator": null } ], "title": "GFP PCR", "reactions": 1, "overage": 0.1 } ], "programs": [ { "stages": [ { "incubations": [ { "label": "Initial denaturation", "temperature_c": 98.0, "seconds": 30, "delta_c": null, "citation": null } ], "cycles": 1, "citation": null }, { "incubations": [ { "label": "Denature", "temperature_c": 98.0, "seconds": 10, "delta_c": null, "citation": null }, { "label": "Anneal", "temperature_c": 63.0, "seconds": 20, "delta_c": null, "citation": null }, { "label": "Extend", "temperature_c": 72.0, "seconds": 20, "delta_c": null, "citation": null } ], "cycles": 20, "citation": { "source": "E1601", "locator": "FAQ 11" } }, { "incubations": [ { "label": "Final extension", "temperature_c": 72.0, "seconds": 120, "delta_c": null, "citation": null } ], "cycles": 1, "citation": null }, { "incubations": [ { "label": "Hold", "temperature_c": 4.0, "seconds": null, "delta_c": null, "citation": null } ], "cycles": 1, "citation": null } ], "title": "GFP PCR", "lid_temperature_c": null } ], "timers": [], "waits": [], "hands_on_seconds": null, "transfers": [], "figures": [ { "records": [ "gfp-amplicon.dna" ], "caption": "The GFP amplicon's forward end: the BbsI site its tail carries, and the ATGA overhang the cut leaves. The reverse end leaves TGGC.", "span": [ 0, 49 ], "linear": true, "sequence_view": true, "enzymes": [ "BbsI" ], "highlight": [ "GFP forward", "BbsI", "BbsI site", "ATGA overhang" ], "citation": null } ], "gels": [], "expected": [ "One band at 749 bp." ], "calculator": null, "troubleshooting": [ { "problem": "No band", "solution": "Drop the annealing temperature by 3 °C and check the GFP template is there.", "citation": { "source": "M0491", "locator": "annealing temperature" } }, { "problem": "Several bands", "solution": "Raise the annealing temperature, or gel-purify the band of the right size.", "citation": { "source": "M0491", "locator": "annealing temperature" } } ], "holes": [] }, { "title": "Check the PCRs on a gel", "key": "pcr-gel", "section": "Make the fragments", "instructions": [ "Use a 1% agarose gel.", "Load 5 µL of each reaction beside the ladder.", "Run until the dye front is two thirds down the gel." ], "cautions": [], "notes": [ { "text": "1% agarose resolves bands of these sizes.", "citation": { "source": "agarose-resolution", "locator": "optimum resolution for linear DNA" } } ], "tables": [], "programs": [], "timers": [], "waits": [], "hands_on_seconds": null, "transfers": [], "figures": [], "gels": [ { "ladder": { "name": "NEB 1 kb Plus DNA Ladder (N3200)", "bands_bp": [ 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1517, 2017, 3001, 4001, 5001, 6001, 8001, 10002 ] }, "lanes": [ { "label": "pUC19 backbone", "bands_bp": [ 2662 ] }, { "label": "GFP", "bands_bp": [ 749 ] } ], "title": "PCR products" } ], "expected": [ "pUC19 backbone: one band at 2662 bp.", "GFP: one band at 749 bp." ], "calculator": null, "troubleshooting": [ { "problem": "A smear or an extra band", "solution": "Gel-purify the band of the right size; a wrong template in the assembly gives wrong clones.", "citation": { "source": "NEB-cloning", "locator": "colonies contain the wrong construct" } } ], "holes": [] }, { "title": "Digest the plasmid template with DpnI", "key": "dpni-digest", "section": "Make the fragments", "instructions": [ "Add 20 units of DpnI to the pUC19 backbone PCR and mix.", "Incubate at 37 °C for 60 minutes." ], "cautions": [], "notes": [ { "text": "DpnI cuts GATC only where Dam has methylated it, so it cuts pUC19 (15 Dam sites) and leaves the PCR product, which carries no methylation.", "citation": { "source": "REBASE-DpnI", "locator": "DpnI" } }, { "text": "The kit's own protocol has no step for a methylated template, so the incubation is this package's choice.", "citation": { "source": "E1601", "locator": "" } } ], "tables": [], "programs": [], "timers": [ { "label": "DpnI digest", "seconds": 3600 } ], "waits": [], "hands_on_seconds": null, "transfers": [], "figures": [], "gels": [], "expected": [ "Nothing visible. The digest shows up later as fewer colonies carrying the template plasmid." ], "calculator": null, "troubleshooting": [ { "problem": "Many colonies on the no-insert control", "solution": "The template survived: digest longer, or use more DpnI.", "citation": { "source": "NEB-cloning", "locator": "colonies contain the wrong construct" } } ], "holes": [] }, { "title": "Purify every amplicon", "key": "purify-amplicons", "section": "Make the fragments", "instructions": [ "Run each reaction over a Monarch Spin PCR & DNA Cleanup column and elute in the smallest volume the kit allows." ], "cautions": [], "notes": [ { "text": "The reaction takes purified amplicons: polymerase carried over from the PCR fills in the four-base overhangs, which blunts the ends and mis-assembles them.", "citation": { "source": "E1601", "locator": "" } } ], "tables": [], "programs": [], "timers": [], "waits": [], "hands_on_seconds": null, "transfers": [], "figures": [], "gels": [], "expected": [ "Clean DNA, free of polymerase, primers and dNTPs." ], "calculator": null, "troubleshooting": [ { "problem": "Low recovery", "solution": "Elute in a larger volume and leave the buffer on the column longer.", "citation": { "source": "T1130", "locator": "troubleshooting, low DNA yield" } } ], "holes": [] }, { "title": "Measure every concentration", "key": "quantify", "section": "Make the fragments", "instructions": [ "Measure each purified amplicon by A260 (NanoDrop) or with a fluorometer (Qubit).", "Enter each concentration in the next table's Stock column." ], "cautions": [], "notes": [], "tables": [], "programs": [], "timers": [], "waits": [], "hands_on_seconds": null, "transfers": [], "figures": [], "gels": [], "expected": [ "pUC19 backbone: 0.05 pmol is 81.98 ng, so 82 ng/µL or more fits in 1 µL.", "GFP: 0.05 pmol is 23.07 ng, so 23 ng/µL or more fits in 1 µL." ], "calculator": null, "troubleshooting": [ { "problem": "Too dilute to fit in the reaction", "solution": "Concentrate the amplicon, or scale the reaction up.", "citation": null } ], "holes": [] }, { "title": "Set up the Golden Gate reaction", "key": "set-up-assembly", "section": "Assemble", "instructions": [ "Thaw the master mix on ice and mix it well; it is viscous.", "Pipette the volume that gives each fragment its picomoles, and make the difference up with water.", "Pipette the DNA into the tube first, then the rest.", "Mix gently and spin down." ], "cautions": [], "notes": [], "tables": [ { "components": [ { "name": "pUC19 backbone", "volume_ul": 1.0, "stock": "", "final": "0.05 pmol (81.98 ng)", "master_mix": false, "citation": { "source": "NEBioCalculator", "locator": "dsDNA molecular weight" }, "calculator": { "nanograms": 81.98, "made_up_by": "Nuclease-free water", "too_dilute": "Too dilute to fit in the reaction", "least_ul": null, "too_concentrated": "" } }, { "name": "GFP", "volume_ul": 1.0, "stock": "", "final": "0.05 pmol (23.07 ng)", "master_mix": false, "citation": { "source": "NEBioCalculator", "locator": "dsDNA molecular weight" }, "calculator": { "nanograms": 23.07, "made_up_by": "Nuclease-free water", "too_dilute": "Too dilute to fit in the reaction", "least_ul": null, "too_concentrated": "" } }, { "name": "NEBridge Ligase Master Mix", "volume_ul": 5.0, "stock": "3X", "final": "1X", "master_mix": true, "citation": { "source": "M1100", "locator": "reaction" }, "calculator": null }, { "name": "BbsI-HF (R3539)", "volume_ul": 1.0, "stock": "20 U/µL", "final": "20 units", "master_mix": true, "citation": { "source": "M1100", "locator": "enzyme amounts" }, "calculator": null }, { "name": "Nuclease-free water", "volume_ul": 7.0, "stock": "", "final": "to 15 µL", "master_mix": true, "citation": null, "calculator": null } ], "title": "Golden Gate assembly, NEBridge Ligase Master Mix (M1100)", "reactions": 1, "overage": 0.1 } ], "programs": [], "timers": [], "waits": [], "hands_on_seconds": null, "transfers": [], "figures": [], "gels": [], "expected": [ "A 15 µL reaction holding every fragment." ], "calculator": null, "troubleshooting": [ { "problem": "The DNA does not fit the reaction volume", "solution": "Concentrate the fragments, or scale the whole reaction up.", "citation": { "source": "E1601", "locator": "assembly reaction, note 6" } } ], "holes": [] }, { "title": "Run the Golden Gate program", "key": "run-assembly", "section": "Assemble", "instructions": [ "Put the tube in the thermocycler and run the program below." ], "cautions": [], "notes": [ { "text": "The fidelity this design was scored on is read from measured ligation counts.", "citation": { "source": "pryor-2020", "locator": "Pryor 2020 S4 Table, measured with BbsI-HF" } }, "Junction positions are 1-based, on the product." ], "tables": [], "programs": [ { "stages": [ { "incubations": [ { "label": "Assembly", "temperature_c": 37.0, "seconds": 900, "delta_c": null, "citation": null } ], "cycles": 1, "citation": { "source": "M1100", "locator": "cycling" } }, { "incubations": [ { "label": "End soak", "temperature_c": 60.0, "seconds": 300, "delta_c": null, "citation": null } ], "cycles": 1, "citation": { "source": "M1100", "locator": "cycling" } } ], "title": "Golden Gate assembly", "lid_temperature_c": null }, { "stages": [ { "incubations": [ { "label": "Heat inactivation", "temperature_c": 65.0, "seconds": 1200, "delta_c": null, "citation": null } ], "cycles": 1, "citation": null } ], "title": "BbsI heat inactivation", "lid_temperature_c": null } ], "timers": [], "waits": [], "hands_on_seconds": null, "transfers": [], "figures": [ { "records": [ "product.dna" ], "caption": "pUC19-GFP as the reaction closes it: the ATGA and TGGC junctions it spells, and every BbsI site left on it.", "span": null, "linear": false, "sequence_view": false, "enzymes": [ "BbsI" ], "highlight": [ "ATGA junction", "TGGC junction" ], "citation": null } ], "gels": [], "expected": [ "Nothing visible. The 60 °C soak at the end is a digest, not heat inactivation: it cuts vector that never opened or has closed again, so fewer empty colonies grow.", "The product carries ATGA at 396, joining pUC19 backbone to GFP.", "The product carries TGGC at 1113, joining GFP to pUC19 backbone." ], "calculator": null, "troubleshooting": [ { "problem": "Mostly empty vector later", "solution": "Keep the 60 °C soak, and check the template was digested with DpnI.", "citation": { "source": "E1601", "locator": "FAQ 10" } }, { "problem": "Few colonies later", "solution": "Raise the cycle count, or plate more of the outgrowth.", "citation": { "source": "E1601", "locator": "FAQ 14" } } ], "holes": [] }, { "title": "Transform and plate", "key": "transform", "section": "Transform and screen", "instructions": [ "Thaw 50 µL of NEB 5-alpha Competent E. coli (C2987) on ice for 10 minutes.", "Add 2 µL of the assembly and flick the tube four or five times.", "Hold on ice for 30 minutes.", "Heat shock at 42 °C for 30 seconds.", "Return to ice for 5 minutes.", "Add 950 µL of outgrowth medium and shake at 37 °C for 60 minutes at 250 rpm.", "Spread 50 µL of a 1:5 dilution on a warmed plate and grow overnight at 37 °C." ], "cautions": [ "Competent cells die if they warm up; keep them on ice until the shock." ], "notes": [ "The plate reads colour only with an alpha-complementing host, such as NEB 5-alpha Competent E. coli (C2987). A host that cannot complement gives white colonies whatever the clone carries.", "The clone is not expected to make GFP: it reads on the opposite strand from lac promoter and no ribosome binding site is annotated ahead of it." ], "tables": [], "programs": [], "timers": [ { "label": "Thaw", "seconds": 600 }, { "label": "On ice", "seconds": 1800 }, { "label": "Heat shock", "seconds": 30 }, { "label": "Back on ice", "seconds": 300 }, { "label": "Outgrowth", "seconds": 3600 } ], "waits": [], "hands_on_seconds": null, "transfers": [], "figures": [], "gels": [], "expected": [ "Hundreds of colonies; NEB counts about 687 correct ones from a single-insert assembly with 2.5 µL of the outgrowth plated.", "Correct clones are white and empty vector is blue: the insertion interrupts lacZα, which is then not there to complete the host's own." ], "calculator": null, "troubleshooting": [ { "problem": "No colonies", "solution": "Check the antibiotic and the cells' efficiency, and plate the rest of the outgrowth.", "citation": { "source": "NEB-cloning", "locator": "few or no transformants" } }, { "problem": "A lawn", "solution": "Plate a smaller volume or a greater dilution next time.", "citation": null } ], "holes": [] }, { "title": "Screen colonies by PCR", "key": "colony-pcr", "section": "Transform and screen", "instructions": [ "Touch a well-separated colony with a sterile toothpick and stir it into the tube until the liquid clouds.", "Streak the same toothpick onto a numbered plate, so the clone survives the PCR.", "Run the program below and load 5 µL on a 2% gel." ], "cautions": [], "notes": [ "The long first step at 94 °C lyses the cells; there is no purified template." ], "tables": [ { "components": [ { "name": "OneTaq Quick-Load 2X Master Mix with Standard Buffer (M0486)", "volume_ul": 12.5, "stock": "2X", "final": "1X", "master_mix": true, "citation": null, "calculator": null }, { "name": "Forward primer", "volume_ul": 0.5, "stock": "10 µM", "final": "200 nM", "master_mix": true, "citation": null, "calculator": null }, { "name": "Reverse primer", "volume_ul": 0.5, "stock": "10 µM", "final": "200 nM", "master_mix": true, "citation": null, "calculator": null }, { "name": "Nuclease-free water", "volume_ul": 11.5, "stock": "", "final": "to 25 µL", "master_mix": true, "citation": null, "calculator": null } ], "title": "Colony PCR", "reactions": 1, "overage": 0.1 } ], "programs": [ { "stages": [ { "incubations": [ { "label": "Lysis", "temperature_c": 94.0, "seconds": 300, "delta_c": null, "citation": null } ], "cycles": 1, "citation": null }, { "incubations": [ { "label": "Denature", "temperature_c": 94.0, "seconds": 30, "delta_c": null, "citation": null }, { "label": "Anneal", "temperature_c": 56.9, "seconds": 30, "delta_c": null, "citation": null }, { "label": "Extend", "temperature_c": 68.0, "seconds": 60, "delta_c": null, "citation": null } ], "cycles": 30, "citation": { "source": "M0480", "locator": "thermocycling conditions" } }, { "incubations": [ { "label": "Final extension", "temperature_c": 68.0, "seconds": 300, "delta_c": null, "citation": null } ], "cycles": 1, "citation": null }, { "incubations": [ { "label": "Hold", "temperature_c": 10.0, "seconds": null, "delta_c": null, "citation": null } ], "cycles": 1, "citation": null } ], "title": "Colony PCR", "lid_temperature_c": null } ], "timers": [], "waits": [], "hands_on_seconds": null, "transfers": [], "figures": [], "gels": [ { "ladder": { "name": "NEB 100 bp DNA Ladder (N3231)", "bands_bp": [ 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1517 ] }, "lanes": [ { "label": "Correct clone", "bands_bp": [ 160, 838 ] }, { "label": "Empty vector", "bands_bp": [ 177 ] } ], "title": "Colony PCR" } ], "expected": [ "Each of the 2 junctions is read: the flanking pair crosses them all, and each junction primer stops inside its own insert.", "Correct clone: 160 bp, 838 bp.", "Empty vector: 177 bp." ], "calculator": null, "troubleshooting": [ { "problem": "No band in any lane", "solution": "The colony was too much material: touch a smaller one, or dilute it.", "citation": { "source": "colony-pcr", "locator": "template" } }, { "problem": "Every colony reads as empty vector", "solution": "The template survived the DpnI digest, or the vector re-closed; check the 60 °C soak ran.", "citation": { "source": "E1601", "locator": "FAQ 10" } } ], "holes": [] }, { "title": "Confirm the clone by sequencing", "key": "sequencing", "section": "Transform and screen", "instructions": [ "Miniprep two or three colonies that read as correct.", "Send each miniprep with both sequencing primers.", "Check each read against product.dna; keep a clone only when every junction and insert reads true." ], "cautions": [], "notes": [ "Only a read across the junctions confirms the assembly, whatever the screen said.", "A provider whose read is shorter than the lengths above needs a further primer inside the inserts." ], "tables": [], "programs": [], "timers": [], "waits": [], "hands_on_seconds": null, "transfers": [], "figures": [], "gels": [], "expected": [ "Sequencing forward anneals 123 bp from its own junction and has to read 840 bp to cover the far one.", "Sequencing reverse anneals 119 bp from its own junction and has to read 836 bp to cover the far one.", "The junctions read as ATGA and TGGC, and the parts match GFP." ], "calculator": null, "troubleshooting": [ { "problem": "The read starts too close to the junction", "solution": "Move the primer further out; the first bases after a primer are unreadable.", "citation": { "source": "genewiz-sanger", "locator": "sequencing primer design" } } ], "holes": [] } ], "sources": { "NEBioCalculator": { "document": "New England Biolabs NEBioCalculator", "edition": "script main-6f3020c533.js, capture 2026-08-28", "url": "", "read_as": "Wayback Machine", "date": "", "note": "docs/research/primer-design-and-pcr.md" }, "N3200": { "document": "New England Biolabs #N3200 1 kb Plus DNA Ladder product page", "edition": "capture 2026-03-07", "url": "", "read_as": "Wayback Machine", "date": "", "note": "docs/research/primer-design-and-pcr.md" }, "N3231": { "document": "New England Biolabs #N3231 100 bp DNA Ladder product page", "edition": "capture 2025-10-31", "url": "", "read_as": "Wayback Machine", "date": "", "note": "docs/research/primer-design-and-pcr.md" }, "agarose-resolution": { "document": "New England Biolabs, Agarose Gel Resolution", "edition": "capture 2024-09-18", "url": "", "read_as": "Wayback Machine", "date": "", "note": "docs/research/primer-design-and-pcr.md" }, "T1130": { "document": "New England Biolabs #T1130 Monarch Spin PCR & DNA Cleanup Kit instruction manual", "edition": "version 1.0 06.24", "url": "", "read_as": "", "date": "2026-09-18", "note": "docs/research/restriction-ligation.md" }, "M0491": { "document": "New England Biolabs #M0491 Q5 High-Fidelity DNA Polymerase protocol page", "edition": "capture 2024-08-04", "url": "", "read_as": "Wayback Machine", "date": "2026-09-12", "note": "" }, "NEB-cloning": { "document": "New England Biolabs, Troubleshooting Guide for Cloning", "edition": "", "url": "https://www.neb.com/en-us/tools-and-resources/troubleshooting-guides/troubleshooting-guide-for-cloning", "read_as": "", "date": "2026-09-18", "note": "docs/research/restriction-ligation.md" }, "colony-pcr": { "document": "New England Biolabs application note, Robust Colony PCR from Multiple E. coli Strains using OneTaq Quick-Load Master Mixes", "edition": "Y. Xu, 11/13", "url": "", "read_as": "", "date": "2026-09-12", "note": "docs/research/primer-design-and-pcr.md" }, "genewiz-sanger": { "document": "Azenta/Genewiz, Sanger sequencing FAQ and technical notes", "edition": "", "url": "", "read_as": "", "date": "2026-09-12", "note": "docs/research/primer-design-and-pcr.md" }, "REBASE-DpnI": { "document": "REBASE enzyme record for DpnI", "edition": "", "url": "http://rebase.neb.com/rebase/rebase.html", "read_as": "", "date": "", "note": "docs/research/golden-gate-assembly.md" }, "potapov-2018": { "document": "Potapov, V. et al. (2018) Comprehensive profiling of four base overhang ligation fidelity by T4 DNA Ligase and application to DNA assembly. ACS Synth. Biol. 7, 2665-2674", "edition": "", "url": "https://doi.org/10.1021/acssynbio.8b00333", "read_as": "", "date": "", "note": "docs/research/golden-gate-assembly.md" }, "M0480": { "document": "New England Biolabs #M0480 OneTaq DNA Polymerase protocol", "edition": "protocols.io version 2, 2022-02-21", "url": "https://dx.doi.org/10.17504/protocols.io.bd24i8gw", "read_as": "", "date": "2026-09-12", "note": "" }, "E1601": { "document": "New England Biolabs #E1601S/L NEBridge Golden Gate Assembly Kit (BsaI-HFv2) instruction manual", "edition": "version 5.0_6/26", "url": "https://www.neb.com/-/media/nebus/files/manuals/manuale1601.pdf", "read_as": "", "date": "2026-09-12", "note": "" }, "M1100": { "document": "New England Biolabs, Protocol for NEBridge Ligase Master Mix (NEB #M1100)", "edition": "capture 2023-03-31", "url": "https://web.archive.org/web/20230331002719id_/https://www.neb.com/protocols/2021/09/14/protocol-for-nebridge-ligase-master-mix-neb-m1100", "read_as": "Wayback Machine", "date": "", "note": "docs/research/golden-gate-assembly.md" }, "pryor-2020": { "document": "Pryor, J.M., Potapov, V., Kucera, R.B., Bilotti, K., Cantor, E.J. and Lohman, G.J.S. (2020) Enabling one-pot Golden Gate assemblies of unprecedented complexity using data-optimized assembly design. PLoS One 15(9): e0238592.", "edition": "", "url": "https://doi.org/10.1371/journal.pone.0238592", "read_as": "", "date": "", "note": "docs/research/ligation-fidelity.md" } }, "holes": [], "bill": null }