Golden Gate assembly: GFP into pUC19

Open pUC19 by PCR across 395-451, amplify GFP with BbsI tails, join the 2 fragments in one Golden Gate reaction, and confirm the clone by colony PCR and sequencing.

Vector: pUC19, 2686 bp
Insert: GFP, 717 bp
Enzyme: BbsI-HF (R3539) at 37 °C
Fragments: 2 in one reaction
Overhangs: ATGA and TGGC
Fidelity: 100%, measured
Product: pUC19-GFP, 3347 bp
Selection: ampicillin or carbenicillin

One reaction joins 2 fragments: pUC19 backbone (2630 bp) and GFP (717 bp).

GFP reads on the opposite strand from lac promoter, 61 bp away, so that promoter does not transcribe it.

There is no ribosome binding site annotated ahead of GFP, so the clone is not expected to make its protein.

The insertion interrupts lacZα, so correct clones are white and empty vector is blue on X-gal and IPTG.

sitespass
pUC19 backbonepass
GFPpass
junctionspass
primerswarn

primers warn: 9 designed, 5 with a warning, 0 failing: GC on 2, GC clamp on 2, Tm on 1; not judged: full-primer Tm, 3' end stability

Materials

Name	Supplier	Catalogue	Storage	Per run	Note
pUC19 plasmid			-20 °C		PCR template
GFP template			-20 °C		PCR template
Q5 DNA Polymerase and its reaction buffer	New England Biolabs		-20 °C
dNTP mix			-20 °C		10 mM of each base
DpnI	New England Biolabs		-20 °C	20 units per PCR	cuts the methylated plasmid template only
PCR and gel cleanup spin columns
NEBridge Ligase Master Mix	New England Biolabs	M1100	-20 °C	5 µL per reaction
BbsI-HF	New England Biolabs	R3539	-20 °C	1 µL per reaction
NEB 5-alpha Competent E. coli	New England Biolabs	C2987	-80 °C	50 µL per transformation
SOC or NEB 10-beta/Stable Outgrowth Medium				950 µL per transformation
LB agar plates with ampicillin or carbenicillin, 80 µg/mL X-gal and 200 µM IPTG				one plate per transformation
OneTaq Quick-Load 2X Master Mix with Standard Buffer	New England Biolabs	M0486	-20 °C	12.5 µL per reaction
Agarose and 1X TAE or TBE
NEB 1 kb Plus DNA Ladder	New England Biolabs	N3200
NEB 100 bp DNA Ladder	New England Biolabs	N3231

Equipment: Thermocycler with a heated lid, Agarose gel rig and power supply, Microcentrifuge, Spectrophotometer or fluorometer, Heat block or water bath at 42 °C, Shaking incubator and a plate incubator at 37 °C

Oligos

Name	Sequence (5'→3')	Length	Tm (°C)	For	Working stock	Checks
pUC19 backbone forward	`AAACACGAAGACAATGGCGTAATCATGGTCATAGCTGTTTCC`	42	63.0	Amplify pUC19 backbone	10 µM	pass
pUC19 backbone reverse	`AAACACGAAGACAATCATACTGGCCGTCGTTTTACA`	36	64.1	Amplify pUC19 backbone	10 µM	warn
GFP forward	`AAACACGAAGACAAATGAGTAAAGGAGAAGAACTTTTCACTGG`	43	63.0	Amplify GFP	10 µM	pass
GFP reverse	`AAACACGAAGACAAGCCACTATTTGTATAGTTCATCCATGCCATG`	45	63.1	Amplify GFP	10 µM	warn
Colony PCR forward	`CGATTAAGTTGGGTAACGCCAGGGTTTT`	28	62.4	Screen colonies by PCR	10 µM	pass
Colony PCR reverse	`GTTAGCTCACTCATTAGGCACCCCA`	25	62.2	Screen colonies by PCR	10 µM	warn
Junction reverse	`CACCCTCTCCACTGACAGAAAATTTGTGC`	29	62.9	Screen colonies by PCR	10 µM	pass
Sequencing forward	`AACTGTTGGGAAGGGC`	16	62.0	Confirm the clone by sequencing	10 µM	warn
Sequencing reverse	`ACGCAATTAATGTGAGTTAGCT`	22	61.7	Confirm the clone by sequencing	10 µM	warn

Checks on 5 of 9 oligos

pUC19 backbone reverse warn: Tm 64.1 °C (band 60-64)
GFP reverse warn: GC 37% (band 40-60)
Colony PCR reverse warn: GC clamp 4 (proposed band 1-3)
Sequencing forward warn: GC clamp 4 (proposed band 1-3)
Sequencing reverse warn: GC 36% (band 40-60)

1Amplify pUC19 backbone

Caution: Keep the polymerase on ice.

Thaw the buffer, dNTPs and primers on ice, then vortex and spin them down.
Mix the master mix and put it in each tube, then add the pUC19 template.
Run the program below: 64 °C annealing and 60 s extension for a 2662 bp product.

pUC19 backbone PCR

Reactions mix includes 10% extra

Component	Stock	Final	1 rxn (µL)	Mix for 1 (µL)
Q5 Reaction Buffer	5X	1X	10	11
dNTP mix	10 mM each	200 µM each	1	1.1
Forward primer	10 µM	500 nM	2.5	2.75
Reverse primer	10 µM	500 nM	2.5	2.75
Template DNA			1	each tube
Q5 DNA Polymerase	2 U/µL	1 units	0.5	0.55
Nuclease-free water		to 50 µL	32.5	35.75
Total			50	53.9

Put 49 µL of mix in each tube, then add 1 µL Template DNA.

pUC19 backbone PCR · 32 min 30 s plus ramps

Step	Temperature	Time	Cycles
Initial denaturation	98 °C	30 s	1
Denature	98 °C	10 s	20
Anneal	64 °C	20 s
Extend	72 °C	1 min
Final extension	72 °C	2 min	1
Hold	4 °C	∞	1

Expected result

One band at 2662 bp.

Troubleshooting

No band: Drop the annealing temperature by 3 °C and check the pUC19 template is there.
Several bands: Raise the annealing temperature, or gel-purify the band of the right size.

Notes

20 cycles, which is the fewest NEB finds enough for an amplicon going into an assembly; fewer cycles means fewer PCR errors.
The primers carry a BbsI site pointing back into the part, so cutting the amplicon leaves TGGC and ATGA.

2Amplify GFP

Caution: Keep the polymerase on ice.

Thaw the buffer, dNTPs and primers on ice, then vortex and spin them down.
Mix the master mix and put it in each tube, then add the GFP template.
Run the program below: 64 °C annealing and 20 s extension for a 749 bp product.

GFP PCR

Reactions mix includes 10% extra

Component	Stock	Final	1 rxn (µL)	Mix for 1 (µL)
Q5 Reaction Buffer	5X	1X	10	11
dNTP mix	10 mM each	200 µM each	1	1.1
Forward primer	10 µM	500 nM	2.5	2.75
Reverse primer	10 µM	500 nM	2.5	2.75
Template DNA			1	each tube
Q5 DNA Polymerase	2 U/µL	1 units	0.5	0.55
Nuclease-free water		to 50 µL	32.5	35.75
Total			50	53.9

Put 49 µL of mix in each tube, then add 1 µL Template DNA.

GFP PCR · 19 min 10 s plus ramps

Step	Temperature	Time	Cycles
Initial denaturation	98 °C	30 s	1
Denature	98 °C	10 s	20
Anneal	64 °C	20 s
Extend	72 °C	20 s
Final extension	72 °C	2 min	1
Hold	4 °C	∞	1

Expected result

One band at 749 bp.

Troubleshooting

No band: Drop the annealing temperature by 3 °C and check the GFP template is there.
Several bands: Raise the annealing temperature, or gel-purify the band of the right size.

Notes

20 cycles, which is the fewest NEB finds enough for an amplicon going into an assembly; fewer cycles means fewer PCR errors.
The primers carry a BbsI site pointing back into the part, so cutting the amplicon leaves ATGA and TGGC.

3Check the PCRs on a gel

Pour a 1% agarose gel.
Load 5 µL of each reaction beside the ladder.
Run until the dye front is two thirds down the gel.

Expected result

pUC19 backbone: one band at 2662 bp.
GFP: one band at 749 bp.

PCR products

L NEB 1 kb Plus DNA Ladder (N3200)
1 pUC19 backbone: 2662 bp
2 GFP: 749 bp

Troubleshooting

A smear or an extra band: Gel-purify the band of the right size; a wrong template in the assembly gives wrong clones.

4Digest the plasmid template with DpnI

Add 20 units of DpnI to the pUC19 backbone PCR and mix.
Incubate at 37 °C for 60 minutes.

Expected result

Nothing visible. The digest shows up later as fewer colonies carrying the template plasmid.

Troubleshooting

Many colonies on the no-insert control: The template survived: digest longer, or use more DpnI.

Notes

DpnI cuts GATC only where Dam has methylated it, so it cuts pUC19 (15 Dam sites) and leaves the PCR product, which carries no methylation.
This step is not in NEB's Golden Gate protocol; the incubation is this package's choice.

5Purify every amplicon

Run each reaction over a spin column and elute in the smallest volume the kit allows.

Expected result

Clean DNA, free of polymerase, primers and dNTPs.

Troubleshooting

Low recovery: Elute twice through the same column, or pool two reactions before purifying.

Notes

NEB asks for purified amplicons: polymerase carried over from the PCR fills in the four-base overhangs, which blunts the ends and mis-assembles them.

6Measure every concentration

Measure each purified amplicon by A260 or with a fluorometer.
Work out the volume that carries the picomoles the next table asks for.

Expected result

pUC19 backbone: 0.05 pmol is 81.98 ng, so 82 ng/µL or more fits in 1 µL.
GFP: 0.05 pmol is 23.07 ng, so 23 ng/µL or more fits in 1 µL.

Troubleshooting

Too dilute to fit in the reaction: Concentrate the amplicon, or scale the reaction up.

Notes

Picomoles, not nanograms: the shorter fragment weighs less at the same molar ratio. Mass to moles here is NEBioCalculator's 36.04 + 615.94 per base pair, which is about 5% off the 650 Da per base pair of NEB's manuals.

7Set up the Golden Gate reaction

Thaw the master mix on ice and mix it well; it is viscous.
Pipette the DNA into the tube first, then the rest.
Mix gently and spin down.

Golden Gate assembly, NEBridge Ligase Master Mix (M1100)

Reactions mix includes 10% extra

Component	Stock	Final	1 rxn (µL)	Mix for 1 (µL)
pUC19 backbone		0.05 pmol (81.98 ng)	1	each tube
GFP		0.05 pmol (23.07 ng)	1	each tube
NEBridge Ligase Master Mix	3X	1X	5	5.5
BbsI-HF (R3539)	20 U/µL	20 units	1	1.1
Nuclease-free water		to 15 µL	7	7.7
Total			15	14.3

Put 13 µL of mix in each tube, then add 1 µL pUC19 backbone, 1 µL GFP.

Expected result

A 15 µL reaction holding every fragment.

Troubleshooting

The DNA does not fit the reaction volume: Concentrate the fragments, or scale the whole reaction up.

Notes

The volumes above assume the concentrations measured in the step before; pipette the volume that gives the picomoles, and make the difference up with water.

8Run the Golden Gate program

Put the tube in the thermocycler and run the program below.

Golden Gate assembly · 20 min plus ramps

Step	Temperature	Time	Cycles
Assembly	37 °C	15 min	1
End soak	60 °C	5 min	1

BbsI heat inactivation · 20 min plus ramps

Step	Temperature	Time	Cycles
Heat inactivation	65 °C	20 min	1

Expected result

Nothing visible. The 60 °C soak at the end is a digest, not heat inactivation: it cuts vector that never opened or has closed again, so fewer empty colonies grow.
The product carries ATGA at 395, joining pUC19 backbone to GFP.
The product carries TGGC at 1112, joining GFP to pUC19 backbone.

Troubleshooting

Mostly empty vector later: Keep the 60 °C soak, and check the template was digested with DpnI.
Few colonies later: Raise the cycle count, or plate more of the outgrowth.

Notes

Junction positions are 0-based, on the product.

9Transform and plate

Caution: Competent cells die if they warm up; keep them on ice until the shock.

Thaw 50 µL of NEB 5-alpha Competent E. coli (C2987) on ice for 10 minutes.
Add 2 µL of the assembly and flick the tube four or five times.
Hold on ice for 30 minutes.
Heat shock at 42 °C for 30 seconds.
Return to ice for 5 minutes.
Add 950 µL of outgrowth medium and shake at 37 °C for 60 minutes at 250 rpm.
Spread 50 µL of a 1:5 dilution on a warmed plate and grow overnight at 37 °C.

Expected result

Hundreds of colonies; NEB counts about 687 correct ones from a single-insert assembly with 2.5 µL of the outgrowth plated.
Correct clones are white and empty vector is blue: the insertion interrupts lacZα, which is then not there to complete the host's own.

Troubleshooting

No colonies: Check the antibiotic and the cells' efficiency, and plate the rest of the outgrowth.
A lawn: Plate a smaller volume or a greater dilution next time.

Notes

The plate reads colour only with an alpha-complementing host, such as NEB 5-alpha Competent E. coli (C2987). A host that cannot complement gives white colonies whatever the clone carries.
The clone is not expected to make GFP: it reads on the opposite strand from lac promoter and no ribosome binding site is annotated ahead of it.

10Screen colonies by PCR

Touch a well-separated colony with a sterile toothpick and stir it into the tube until the liquid clouds.
Streak the same toothpick onto a numbered plate, so the clone survives the PCR.
Run the program below and load 5 µL on a 2% gel.

Colony PCR

Reactions mix includes 10% extra

Component	Stock	Final	1 rxn (µL)	Mix for 1 (µL)
OneTaq Quick-Load 2X Master Mix with Standard Buffer (M0486)	2X	1X	12.5	13.75
Forward primer	10 µM	200 nM	0.5	0.55
Reverse primer	10 µM	200 nM	0.5	0.55
Nuclease-free water		to 25 µL	11.5	12.65
Total			25	27.5

Put 25 µL of mix in each tube.

Colony PCR · 1 h 10 min plus ramps

Step	Temperature	Time	Cycles
Lysis	94 °C	5 min	1
Denature	94 °C	30 s	30
Anneal	57.2 °C	30 s
Extend	68 °C	1 min
Final extension	68 °C	5 min	1
Hold	10 °C	∞	1

Expected result

Each of the 2 junctions is read: the flanking pair crosses them all, and each junction primer stops inside its own insert.
Correct clone: 160 bp, 897 bp.
Empty vector: 236 bp.
Reversed insert: 220 bp, 897 bp.
A reversed insert is told from a correct one, because the two vector primers sit at different distances from their own junctions.

Colony PCR

L NEB 100 bp DNA Ladder (N3231)
1 Correct clone: 160, 897 bp
2 Empty vector: 236 bp
3 Reversed insert: 220, 897 bp

Troubleshooting

No band in any lane: The colony was too much material: touch a smaller one, or dilute it.
Every colony reads as empty vector: The template survived the DpnI digest, or the vector re-closed; check the 60 °C soak ran.

Notes

The long first step at 94 °C lyses the cells; there is no purified template.

11Confirm the clone by sequencing

Miniprep two or three colonies that read as correct.
Send each with both sequencing primers.
Check the read across every junction and the whole of each insert.

Expected result

Sequencing forward anneals 119 bp from its own junction and has to read 836 bp to cover the far one.
Sequencing reverse anneals 113 bp from its own junction and has to read 830 bp to cover the far one.
The junctions read as ATGA and TGGC, and the parts match GFP.

Troubleshooting

The read starts too close to the junction: Move the primer further out; the first bases after a primer are unreadable.

Notes

NEB asks for the assembly to be confirmed by sequencing across the junctions whatever the screen said.
A provider whose read is shorter than the lengths above needs a further primer inside the inserts.

References

NEB, NEBridge Golden Gate Assembly Kit (BsaI-HFv2) instruction manual, NEB #E1601S/L, version 5.0_6/26 https://www.neb.com/-/media/nebus/files/manuals/manuale1601.pdf
NEB, Protocol for NEBridge Ligase Master Mix (NEB #M1100) https://web.archive.org/web/20230331002719id_/https://www.neb.com/protocols/2021/09/14/protocol-for-nebridge-ligase-master-mix-neb-m1100
NEB, NEBridge Ligase Master Mix Protocol Guidelines https://web.archive.org/web/20250713174145id_/https://www.neb.com/en-us/tools-and-resources/usage-guidelines/nebridge-ligase-master-mix-protocol-guidelines
NEB, Usage Guidelines for Golden Gate Assembly with PaqCI https://web.archive.org/web/20210615031818id_/https://www.neb.com/tools-and-resources/usage-guidelines/usage-guidelines-for-golden-gate-assembly-with-paqci
NEB, Robust Colony PCR from Multiple E. coli Strains using OneTaq Quick-Load Master Mixes (Y. Xu, 11/13)
NEB, Nucleic Acid Data, and NEBioCalculator for the ng to pmol conversion
NEB product pages: 1 kb Plus DNA Ladder (N3200), 100 bp DNA Ladder (N3231)
NEB, Agarose Gel Resolution, for the percentage a band range resolves on
Pryor, J.M., Potapov, V., Kucera, R.B., Bilotti, K., Cantor, E.J. and Lohman, G.J.S. (2020) Enabling one-pot Golden Gate assemblies of unprecedented complexity using data-optimized assembly design. PLoS One 15(9): e0238592. S4 Table, measured with BbsI-HF
REBASE record for DpnI, which cuts G6mATC and so only methylated template http://rebase.neb.com/rebase/rebase.html
Potapov, V. et al. (2018) Comprehensive profiling of four base overhang ligation fidelity by T4 DNA Ligase and application to DNA assembly. ACS Synth. Biol. 7, 2665-2674, for the X-gal and IPTG plate https://doi.org/10.1021/acssynbio.8b00333